Variant ID: vg0318061429 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 18061429 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 195. )
CTCCCCCCCCATTTTCATTTAGCCAGGTTATCTTTCATTAGAATTACTTTCTTGTGAAGAAACCAAATAAAGACCTTGATCTTTAGTGGAATTTTCAAGT[C/T]
CCACAGAATTCTCTTTTTATCCGAACATTACAGTTCATGATCGTGGCATACATAGATTTGACGGAAAATTGACCATTCTTATGGAGCGACCATACAAAGA
TCTTTGTATGGTCGCTCCATAAGAATGGTCAATTTTCCGTCAAATCTATGTATGCCACGATCATGAACTGTAATGTTCGGATAAAAAGAGAATTCTGTGG[G/A]
ACTTGAAAATTCCACTAAAGATCAAGGTCTTTATTTGGTTTCTTCACAAGAAAGTAATTCTAATGAAAGATAACCTGGCTAAATGAAAATGGGGGGGGAG
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 68.50% | 31.00% | 0.02% | 0.40% | NA |
All Indica | 2759 | 97.60% | 2.00% | 0.04% | 0.43% | NA |
All Japonica | 1512 | 14.60% | 85.20% | 0.00% | 0.20% | NA |
Aus | 269 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 97.50% | 1.50% | 0.17% | 0.84% | NA |
Indica II | 465 | 97.00% | 2.60% | 0.00% | 0.43% | NA |
Indica III | 913 | 98.90% | 1.00% | 0.00% | 0.11% | NA |
Indica Intermediate | 786 | 96.40% | 3.10% | 0.00% | 0.51% | NA |
Temperate Japonica | 767 | 0.40% | 99.50% | 0.00% | 0.13% | NA |
Tropical Japonica | 504 | 39.50% | 60.10% | 0.00% | 0.40% | NA |
Japonica Intermediate | 241 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 57.80% | 37.80% | 0.00% | 4.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0318061429 | C -> T | LOC_Os03g31634.1 | downstream_gene_variant ; 200.0bp to feature; MODIFIER | silent_mutation | Average:32.983; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
vg0318061429 | C -> T | LOC_Os03g31634-LOC_Os03g31640 | intergenic_region ; MODIFIER | silent_mutation | Average:32.983; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
vg0318061429 | C -> DEL | N | N | silent_mutation | Average:32.983; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0318061429 | NA | 3.87E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0318061429 | NA | 9.20E-08 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0318061429 | NA | 2.89E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0318061429 | 1.22E-07 | 2.52E-12 | mr1750 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0318061429 | NA | 6.51E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0318061429 | NA | 6.46E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0318061429 | NA | 1.48E-09 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0318061429 | NA | 1.52E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |