Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0317957936:

Variant ID: vg0317957936 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17957936
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AGAATCAAGGTTACTGGCTGGCTGGACAGAGACCGGAAGTTCCGGGCCAAGAACACCGGAACTTTTGGCCTGCAAAACTGAAGAATAGAGGATTCAAACA[T/G,A]
GCCAGTGCATGTGTCAAAATCCTATAGATCGGCAATCTGCAAGGTAGCAGGAACAATTCTATTCAAAAGGTTTTCTCCCTAGGTTCACATATTTAGAGAT

Reverse complement sequence

ATCTCTAAATATGTGAACCTAGGGAGAAAACCTTTTGAATAGAATTGTTCCTGCTACCTTGCAGATTGCCGATCTATAGGATTTTGACACATGCACTGGC[A/C,T]
TGTTTGAATCCTCTATTCTTCAGTTTTGCAGGCCAAAAGTTCCGGTGTTCTTGGCCCGGAACTTCCGGTCTCTGTCCAGCCAGCCAGTAACCTTGATTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 37.10% 0.08% 0.04% A: 0.04%
All Indica  2759 96.60% 3.30% 0.11% 0.07% NA
All Japonica  1512 15.10% 84.90% 0.00% 0.00% NA
Aus  269 8.90% 91.10% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.00% 0.17% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 97.40% 2.40% 0.11% 0.11% NA
Indica Intermediate  786 94.00% 5.90% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 37.30% 62.70% 0.00% 0.00% NA
Japonica Intermediate  241 15.80% 84.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 51.10% 45.60% 1.11% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317957936 T -> A LOC_Os03g31530.1 downstream_gene_variant ; 1602.0bp to feature; MODIFIER silent_mutation Average:43.361; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0317957936 T -> A LOC_Os03g31520.1 intron_variant ; MODIFIER silent_mutation Average:43.361; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0317957936 T -> DEL N N silent_mutation Average:43.361; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0317957936 T -> G LOC_Os03g31530.1 downstream_gene_variant ; 1602.0bp to feature; MODIFIER silent_mutation Average:43.361; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0317957936 T -> G LOC_Os03g31520.1 intron_variant ; MODIFIER silent_mutation Average:43.361; most accessible tissue: Minghui63 root, score: 54.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317957936 NA 1.33E-26 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 8.48E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 7.03E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 2.33E-20 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 1.50E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 1.72E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 7.54E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 6.94E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 1.41E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 4.34E-33 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 1.23E-57 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 2.08E-51 mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 1.67E-61 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 1.27E-06 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 3.33E-06 NA mr1136_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 5.83E-09 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 2.20E-12 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 1.01E-36 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 3.87E-39 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 5.66E-22 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 7.99E-06 NA mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 2.81E-31 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 5.53E-26 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 1.99E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 2.71E-39 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 1.11E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 2.83E-16 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 5.81E-50 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 6.53E-42 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 4.86E-06 NA mr1784_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 1.83E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317957936 NA 3.46E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251