| Variant ID: vg0317880579 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17880579 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 286. )
AAGGCCCTTTTGCACATATTTACTCAAGACACTAGTTTGAAAATTAACTATCATAAGTCTAATATCTATCCGTTGAATGTCCCTGAGGAGAAATTGAAAA[A/T]
TCTGGCTCTGTTGTTGGGATGTAAAGTGGGTTCTATGCCCTTCACTTGTCTAGGCTTGCCAATGAGTACTACAAGGCCAAGAGTGATTGATATGACACCA
TGGTGTCATATCAATCACTCTTGGCCTTGTAGTACTCATTGGCAAGCCTAGACAAGTGAAGGGCATAGAACCCACTTTACATCCCAACAACAGAGCCAGA[T/A]
TTTTCAATTTCTCCTCAGGGACATTCAACGGATAGATATTAGACTTATGATAGTTAATTTTCAAACTAGTGTCTTGAGTAAATATGTGCAAAAGGGCCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.90% | 15.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.90% | 34.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317880579 | A -> T | LOC_Os03g31400.1 | upstream_gene_variant ; 4314.0bp to feature; MODIFIER | silent_mutation | Average:61.306; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0317880579 | A -> T | LOC_Os03g31390.1 | downstream_gene_variant ; 2339.0bp to feature; MODIFIER | silent_mutation | Average:61.306; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0317880579 | A -> T | LOC_Os03g31370-LOC_Os03g31390 | intergenic_region ; MODIFIER | silent_mutation | Average:61.306; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317880579 | NA | 1.04E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317880579 | 9.45E-06 | 9.45E-06 | mr1362 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317880579 | 5.21E-07 | NA | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317880579 | NA | 3.04E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317880579 | 1.70E-07 | 1.45E-10 | mr1852 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317880579 | NA | 1.36E-09 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317880579 | NA | 5.29E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317880579 | NA | 1.91E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317880579 | NA | 1.12E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |