\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317880579:

Variant ID: vg0317880579 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17880579
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGCCCTTTTGCACATATTTACTCAAGACACTAGTTTGAAAATTAACTATCATAAGTCTAATATCTATCCGTTGAATGTCCCTGAGGAGAAATTGAAAA[A/T]
TCTGGCTCTGTTGTTGGGATGTAAAGTGGGTTCTATGCCCTTCACTTGTCTAGGCTTGCCAATGAGTACTACAAGGCCAAGAGTGATTGATATGACACCA

Reverse complement sequence

TGGTGTCATATCAATCACTCTTGGCCTTGTAGTACTCATTGGCAAGCCTAGACAAGTGAAGGGCATAGAACCCACTTTACATCCCAACAACAGAGCCAGA[T/A]
TTTTCAATTTCTCCTCAGGGACATTCAACGGATAGATATTAGACTTATGATAGTTAATTTTCAAACTAGTGTCTTGAGTAAATATGTGCAAAAGGGCCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 7.80% 0.00% 0.00% NA
All Indica  2759 93.60% 6.40% 0.00% 0.00% NA
All Japonica  1512 87.60% 12.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.10% 2.90% 0.00% 0.00% NA
Indica II  465 84.90% 15.10% 0.00% 0.00% NA
Indica III  913 96.70% 3.30% 0.00% 0.00% NA
Indica Intermediate  786 92.40% 7.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 65.90% 34.10% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317880579 A -> T LOC_Os03g31400.1 upstream_gene_variant ; 4314.0bp to feature; MODIFIER silent_mutation Average:61.306; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0317880579 A -> T LOC_Os03g31390.1 downstream_gene_variant ; 2339.0bp to feature; MODIFIER silent_mutation Average:61.306; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0317880579 A -> T LOC_Os03g31370-LOC_Os03g31390 intergenic_region ; MODIFIER silent_mutation Average:61.306; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317880579 NA 1.04E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317880579 9.45E-06 9.45E-06 mr1362 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317880579 5.21E-07 NA mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317880579 NA 3.04E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317880579 1.70E-07 1.45E-10 mr1852 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317880579 NA 1.36E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317880579 NA 5.29E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317880579 NA 1.91E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317880579 NA 1.12E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251