\
| Variant ID: vg0317756145 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17756145 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 200. )
CAGTAAACATTTACTAATGGCGGATTAATTAGGCTTAATAAATCCGTCTCGTGGTTTACTGACGGATTCTGTAATTAGTTTTTTTATTAGTGCCCTAACA[C/T]
CCCATATGACACCCTATATAATACCCGATGTGACACGCCAAAACTTTACACTCCTGGATCTAAACACCCCCTAAGGTGTTGTTAAGATGTCTTGCTTTAT
ATAAAGCAAGACATCTTAACAACACCTTAGGGGGTGTTTAGATCCAGGAGTGTAAAGTTTTGGCGTGTCACATCGGGTATTATATAGGGTGTCATATGGG[G/A]
TGTTAGGGCACTAATAAAAAAACTAATTACAGAATCCGTCAGTAAACCACGAGACGGATTTATTAAGCCTAATTAATCCGCCATTAGTAAATGTTTACTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.20% | 0.08% | 0.21% | NA |
| All Indica | 2759 | 97.70% | 2.00% | 0.04% | 0.22% | NA |
| All Japonica | 1512 | 8.30% | 91.60% | 0.00% | 0.13% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.70% | 0.00% | 0.17% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 96.70% | 2.80% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 22.40% | 77.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 44.40% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317756145 | C -> T | LOC_Os03g31180.3 | upstream_gene_variant ; 1684.0bp to feature; MODIFIER | silent_mutation | Average:55.782; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| vg0317756145 | C -> T | LOC_Os03g31180.1 | intron_variant ; MODIFIER | silent_mutation | Average:55.782; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| vg0317756145 | C -> T | LOC_Os03g31180.2 | intron_variant ; MODIFIER | silent_mutation | Average:55.782; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| vg0317756145 | C -> DEL | N | N | silent_mutation | Average:55.782; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317756145 | NA | 2.77E-15 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | NA | 1.25E-15 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | NA | 5.52E-12 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | NA | 1.25E-15 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | NA | 1.42E-77 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | NA | 2.07E-09 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | 9.67E-08 | 6.69E-133 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | 2.40E-10 | 9.86E-23 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | NA | 2.19E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | NA | 6.00E-102 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | 9.95E-10 | 9.94E-10 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | NA | 5.76E-113 | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | NA | 2.19E-13 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | 4.86E-07 | 7.26E-172 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | 3.64E-12 | 1.15E-34 | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | NA | 2.86E-06 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317756145 | 5.04E-10 | 1.26E-14 | mr1987_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |