\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317655545:

Variant ID: vg0317655545 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17655545
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATTTGAATTTGAAAATATGACAACTTCAAATAACATTTTCATATACTAAATGATTTCAACTAAAAAAGTCATCAACAACAAAGTTGTATAACTCATCA[A/T]
GGTCTATAAGTTTTATTTTTTGTCATTTTTCTATATAATGTTTTCTTGAACAGTTTGAATTTGAATTTGAAAATATGACAACTTCAAATAATATTTTCAT

Reverse complement sequence

ATGAAAATATTATTTGAAGTTGTCATATTTTCAAATTCAAATTCAAACTGTTCAAGAAAACATTATATAGAAAAATGACAAAAAATAAAACTTATAGACC[T/A]
TGATGAGTTATACAACTTTGTTGTTGATGACTTTTTTAGTTGAAATCATTTAGTATATGAAAATGTTATTTGAAGTTGTCATATTTTCAAATTCAAATTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 6.90% 0.53% 0.00% NA
All Indica  2759 97.00% 3.00% 0.04% 0.00% NA
All Japonica  1512 96.20% 2.50% 1.26% 0.00% NA
Aus  269 26.00% 72.50% 1.49% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 97.00% 2.80% 0.11% 0.00% NA
Indica Intermediate  786 93.10% 6.90% 0.00% 0.00% NA
Temperate Japonica  767 92.70% 4.80% 2.48% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317655545 A -> T LOC_Os03g30990.1 upstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:15.371; most accessible tissue: Callus, score: 25.401 N N N N
vg0317655545 A -> T LOC_Os03g31000.1 upstream_gene_variant ; 4467.0bp to feature; MODIFIER silent_mutation Average:15.371; most accessible tissue: Callus, score: 25.401 N N N N
vg0317655545 A -> T LOC_Os03g30990-LOC_Os03g31000 intergenic_region ; MODIFIER silent_mutation Average:15.371; most accessible tissue: Callus, score: 25.401 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317655545 NA 5.15E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 4.46E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 7.79E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 5.16E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 5.78E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 6.24E-08 mr1358 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 5.58E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 1.73E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 7.29E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 1.57E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 7.61E-07 2.04E-11 mr1883 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 5.19E-10 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 7.98E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655545 NA 3.62E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251