\
| Variant ID: vg0317655545 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17655545 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAATTTGAATTTGAAAATATGACAACTTCAAATAACATTTTCATATACTAAATGATTTCAACTAAAAAAGTCATCAACAACAAAGTTGTATAACTCATCA[A/T]
GGTCTATAAGTTTTATTTTTTGTCATTTTTCTATATAATGTTTTCTTGAACAGTTTGAATTTGAATTTGAAAATATGACAACTTCAAATAATATTTTCAT
ATGAAAATATTATTTGAAGTTGTCATATTTTCAAATTCAAATTCAAACTGTTCAAGAAAACATTATATAGAAAAATGACAAAAAATAAAACTTATAGACC[T/A]
TGATGAGTTATACAACTTTGTTGTTGATGACTTTTTTAGTTGAAATCATTTAGTATATGAAAATGTTATTTGAAGTTGTCATATTTTCAAATTCAAATTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 6.90% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 97.00% | 3.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 96.20% | 2.50% | 1.26% | 0.00% | NA |
| Aus | 269 | 26.00% | 72.50% | 1.49% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.00% | 2.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.70% | 4.80% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317655545 | A -> T | LOC_Os03g30990.1 | upstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:15.371; most accessible tissue: Callus, score: 25.401 | N | N | N | N |
| vg0317655545 | A -> T | LOC_Os03g31000.1 | upstream_gene_variant ; 4467.0bp to feature; MODIFIER | silent_mutation | Average:15.371; most accessible tissue: Callus, score: 25.401 | N | N | N | N |
| vg0317655545 | A -> T | LOC_Os03g30990-LOC_Os03g31000 | intergenic_region ; MODIFIER | silent_mutation | Average:15.371; most accessible tissue: Callus, score: 25.401 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317655545 | NA | 5.15E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 4.46E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 7.79E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 5.16E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 5.78E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 6.24E-08 | mr1358 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 5.58E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 1.73E-08 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 7.29E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 1.57E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | 7.61E-07 | 2.04E-11 | mr1883 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 5.19E-10 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 7.98E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655545 | NA | 3.62E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |