| Variant ID: vg0317655045 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17655045 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.20, others allele: 0.00, population size: 200. )
GACCCGGCACGATACAAGGACAACCCAGTTCTGTCCGAGTAGGACTCCTTCCATCTGTAAACTCCGCAATGAATTTCCTTAACGTATGCCGAAAACGTCC[G/A]
TATACGCGCAAGTATACCATATCGATATGTGACGTATATTGAAGGGTAGAGGATATACCTTACCCATAACCCTGACAAGTTTGAGTTTGAATTTGAAAAT
ATTTTCAAATTCAAACTCAAACTTGTCAGGGTTATGGGTAAGGTATATCCTCTACCCTTCAATATACGTCACATATCGATATGGTATACTTGCGCGTATA[C/T]
GGACGTTTTCGGCATACGTTAAGGAAATTCATTGCGGAGTTTACAGATGGAAGGAGTCCTACTCGGACAGAACTGGGTTGTCCTTGTATCGTGCCGGGTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.90% | 34.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.80% | 10.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 19.40% | 80.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 47.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317655045 | G -> A | LOC_Os03g30990.1 | upstream_gene_variant ; 532.0bp to feature; MODIFIER | silent_mutation | Average:50.156; most accessible tissue: Minghui63 flag leaf, score: 62.47 | N | N | N | N |
| vg0317655045 | G -> A | LOC_Os03g31000.1 | upstream_gene_variant ; 4967.0bp to feature; MODIFIER | silent_mutation | Average:50.156; most accessible tissue: Minghui63 flag leaf, score: 62.47 | N | N | N | N |
| vg0317655045 | G -> A | LOC_Os03g30990-LOC_Os03g31000 | intergenic_region ; MODIFIER | silent_mutation | Average:50.156; most accessible tissue: Minghui63 flag leaf, score: 62.47 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317655045 | NA | 2.23E-77 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655045 | 1.99E-06 | 1.35E-10 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655045 | 2.13E-08 | 5.36E-18 | mr1750 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655045 | NA | 1.16E-15 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655045 | 3.18E-07 | 3.18E-07 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655045 | NA | 3.07E-16 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655045 | NA | 1.62E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655045 | NA | 4.55E-10 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655045 | 2.72E-10 | 6.33E-27 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317655045 | NA | 3.17E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |