Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0317655045:

Variant ID: vg0317655045 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17655045
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.20, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

GACCCGGCACGATACAAGGACAACCCAGTTCTGTCCGAGTAGGACTCCTTCCATCTGTAAACTCCGCAATGAATTTCCTTAACGTATGCCGAAAACGTCC[G/A]
TATACGCGCAAGTATACCATATCGATATGTGACGTATATTGAAGGGTAGAGGATATACCTTACCCATAACCCTGACAAGTTTGAGTTTGAATTTGAAAAT

Reverse complement sequence

ATTTTCAAATTCAAACTCAAACTTGTCAGGGTTATGGGTAAGGTATATCCTCTACCCTTCAATATACGTCACATATCGATATGGTATACTTGCGCGTATA[C/T]
GGACGTTTTCGGCATACGTTAAGGAAATTCATTGCGGAGTTTACAGATGGAAGGAGTCCTACTCGGACAGAACTGGGTTGTCCTTGTATCGTGCCGGGTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.90%	34.10%	0.04%	0.00%	NA
All Indica	2759	98.00%	2.00%	0.00%	0.00%	NA
All Japonica	1512	7.30%	92.70%	0.00%	0.00%	NA
Aus	269	88.80%	10.80%	0.37%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.10%	2.90%	0.00%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	19.40%	80.60%	0.00%	0.00%	NA
Japonica Intermediate	241	4.60%	95.40%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	51.10%	47.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317655045	G -> A	LOC_Os03g30990.1	upstream_gene_variant ; 532.0bp to feature; MODIFIER	silent_mutation	Average:50.156; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0317655045	G -> A	LOC_Os03g31000.1	upstream_gene_variant ; 4967.0bp to feature; MODIFIER	silent_mutation	Average:50.156; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0317655045	G -> A	LOC_Os03g30990-LOC_Os03g31000	intergenic_region ; MODIFIER	silent_mutation	Average:50.156; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317655045	NA	2.23E-77	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045	1.99E-06	1.35E-10	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045	2.13E-08	5.36E-18	mr1750	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045	NA	1.16E-15	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045	3.18E-07	3.18E-07	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045	NA	3.07E-16	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045	NA	1.62E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045	NA	4.55E-10	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045	2.72E-10	6.33E-27	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045	NA	3.17E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251