\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317655045:

Variant ID: vg0317655045 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17655045
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.20, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GACCCGGCACGATACAAGGACAACCCAGTTCTGTCCGAGTAGGACTCCTTCCATCTGTAAACTCCGCAATGAATTTCCTTAACGTATGCCGAAAACGTCC[G/A]
TATACGCGCAAGTATACCATATCGATATGTGACGTATATTGAAGGGTAGAGGATATACCTTACCCATAACCCTGACAAGTTTGAGTTTGAATTTGAAAAT

Reverse complement sequence

ATTTTCAAATTCAAACTCAAACTTGTCAGGGTTATGGGTAAGGTATATCCTCTACCCTTCAATATACGTCACATATCGATATGGTATACTTGCGCGTATA[C/T]
GGACGTTTTCGGCATACGTTAAGGAAATTCATTGCGGAGTTTACAGATGGAAGGAGTCCTACTCGGACAGAACTGGGTTGTCCTTGTATCGTGCCGGGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 34.10% 0.04% 0.00% NA
All Indica  2759 98.00% 2.00% 0.00% 0.00% NA
All Japonica  1512 7.30% 92.70% 0.00% 0.00% NA
Aus  269 88.80% 10.80% 0.37% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 19.40% 80.60% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317655045 G -> A LOC_Os03g30990.1 upstream_gene_variant ; 532.0bp to feature; MODIFIER silent_mutation Average:50.156; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0317655045 G -> A LOC_Os03g31000.1 upstream_gene_variant ; 4967.0bp to feature; MODIFIER silent_mutation Average:50.156; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0317655045 G -> A LOC_Os03g30990-LOC_Os03g31000 intergenic_region ; MODIFIER silent_mutation Average:50.156; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317655045 NA 2.23E-77 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045 1.99E-06 1.35E-10 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045 2.13E-08 5.36E-18 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045 NA 1.16E-15 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045 3.18E-07 3.18E-07 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045 NA 3.07E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045 NA 1.62E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045 NA 4.55E-10 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045 2.72E-10 6.33E-27 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317655045 NA 3.17E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251