\
| Variant ID: vg0317274577 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17274577 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 209. )
AATGATGCAGACGTGCAAGGGGAACACAAGGACGGTTTGTGGCTATTTGCATAAAGGCGGATGTAAAACATTTTATTAAGCAAAACAGTAAAACAGTTGA[G/A]
TGATTAAAGTAACATTAAATCTCCACTGATCAACGCTACACCACGTTGAACAGGCCCAACCAACCCACCTGAACTACTGTGCATTGAGTCGATTTATTAA
TTAATAAATCGACTCAATGCACAGTAGTTCAGGTGGGTTGGTTGGGCCTGTTCAACGTGGTGTAGCGTTGATCAGTGGAGATTTAATGTTACTTTAATCA[C/T]
TCAACTGTTTTACTGTTTTGCTTAATAAAATGTTTTACATCCGCCTTTATGCAAATAGCCACAAACCGTCCTTGTGTTCCCCTTGCACGTCTGCATCATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 6.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 21.20% | 78.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317274577 | G -> A | LOC_Os03g30264.1 | upstream_gene_variant ; 2585.0bp to feature; MODIFIER | silent_mutation | Average:64.464; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| vg0317274577 | G -> A | LOC_Os03g30270.1 | upstream_gene_variant ; 1408.0bp to feature; MODIFIER | silent_mutation | Average:64.464; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| vg0317274577 | G -> A | LOC_Os03g30280.1 | downstream_gene_variant ; 4028.0bp to feature; MODIFIER | silent_mutation | Average:64.464; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| vg0317274577 | G -> A | LOC_Os03g30264-LOC_Os03g30270 | intergenic_region ; MODIFIER | silent_mutation | Average:64.464; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317274577 | NA | 6.31E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 5.47E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 2.20E-09 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 6.93E-06 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 7.01E-08 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 5.87E-07 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 7.27E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 1.56E-12 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 2.38E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 1.82E-07 | mr1952 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 6.79E-09 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | 9.17E-07 | NA | mr1270_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317274577 | NA | 1.93E-08 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |