\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317235751:

Variant ID: vg0317235751 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17235751
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTAAGCCACTAACGGTTTGGCGGGACTTCTAGAAAGTAAAAATGAACACGATAATTATGTTCGATTTTTAAAATCTCAATGACAATAAAGAGAAGAGA[C/T]
AATGGACGGGCTATAGAGGAGTATAATGGCAACGTTTGACGGGACGTCTAGAAATTATAAAAACGAAACCCAACGTGACAATAAACTCTAAAAACTATAA

Reverse complement sequence

TTATAGTTTTTAGAGTTTATTGTCACGTTGGGTTTCGTTTTTATAATTTCTAGACGTCCCGTCAAACGTTGCCATTATACTCCTCTATAGCCCGTCCATT[G/A]
TCTCTTCTCTTTATTGTCATTGAGATTTTAAAAATCGAACATAATTATCGTGTTCATTTTTACTTTCTAGAAGTCCCGCCAAACCGTTAGTGGCTTAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.90% 0.20% 0.63% 60.26% NA
All Indica  2759 8.00% 0.30% 0.98% 90.72% NA
All Japonica  1512 96.20% 0.00% 0.00% 3.84% NA
Aus  269 10.00% 0.00% 1.12% 88.85% NA
Indica I  595 5.50% 0.00% 1.34% 93.11% NA
Indica II  465 12.70% 0.00% 1.51% 85.81% NA
Indica III  913 7.20% 0.50% 0.55% 91.68% NA
Indica Intermediate  786 7.90% 0.50% 0.89% 90.71% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 89.10% 0.00% 0.00% 10.91% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 0.00% 0.00% 11.46% NA
Intermediate  90 58.90% 0.00% 0.00% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317235751 C -> T LOC_Os03g30200.1 upstream_gene_variant ; 830.0bp to feature; MODIFIER silent_mutation Average:26.891; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0317235751 C -> T LOC_Os03g30200.2 upstream_gene_variant ; 830.0bp to feature; MODIFIER silent_mutation Average:26.891; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0317235751 C -> T LOC_Os03g30190-LOC_Os03g30200 intergenic_region ; MODIFIER silent_mutation Average:26.891; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0317235751 C -> DEL N N silent_mutation Average:26.891; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317235751 NA 1.35E-07 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 2.10E-10 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 1.45E-18 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 6.98E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 1.00E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 1.65E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 1.31E-06 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 1.47E-10 mr1645_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 5.18E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 1.81E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 2.07E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 6.93E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 6.49E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 5.53E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751 NA 2.05E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251