Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0317235751:

Variant ID: vg0317235751 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17235751
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTAAGCCACTAACGGTTTGGCGGGACTTCTAGAAAGTAAAAATGAACACGATAATTATGTTCGATTTTTAAAATCTCAATGACAATAAAGAGAAGAGA[C/T]
AATGGACGGGCTATAGAGGAGTATAATGGCAACGTTTGACGGGACGTCTAGAAATTATAAAAACGAAACCCAACGTGACAATAAACTCTAAAAACTATAA

Reverse complement sequence

TTATAGTTTTTAGAGTTTATTGTCACGTTGGGTTTCGTTTTTATAATTTCTAGACGTCCCGTCAAACGTTGCCATTATACTCCTCTATAGCCCGTCCATT[G/A]
TCTCTTCTCTTTATTGTCATTGAGATTTTAAAAATCGAACATAATTATCGTGTTCATTTTTACTTTCTAGAAGTCCCGCCAAACCGTTAGTGGCTTAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	0.20%	0.63%	60.26%	NA
All Indica	2759	8.00%	0.30%	0.98%	90.72%	NA
All Japonica	1512	96.20%	0.00%	0.00%	3.84%	NA
Aus	269	10.00%	0.00%	1.12%	88.85%	NA
Indica I	595	5.50%	0.00%	1.34%	93.11%	NA
Indica II	465	12.70%	0.00%	1.51%	85.81%	NA
Indica III	913	7.20%	0.50%	0.55%	91.68%	NA
Indica Intermediate	786	7.90%	0.50%	0.89%	90.71%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	89.10%	0.00%	0.00%	10.91%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	88.50%	0.00%	0.00%	11.46%	NA
Intermediate	90	58.90%	0.00%	0.00%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317235751	C -> T	LOC_Os03g30200.1	upstream_gene_variant ; 830.0bp to feature; MODIFIER	silent_mutation	Average:26.891; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0317235751	C -> T	LOC_Os03g30200.2	upstream_gene_variant ; 830.0bp to feature; MODIFIER	silent_mutation	Average:26.891; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0317235751	C -> T	LOC_Os03g30190-LOC_Os03g30200	intergenic_region ; MODIFIER	silent_mutation	Average:26.891; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0317235751	C -> DEL	N	N	silent_mutation	Average:26.891; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317235751	NA	1.35E-07	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	2.10E-10	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	1.45E-18	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	6.98E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	1.00E-16	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	1.65E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	1.31E-06	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	1.47E-10	mr1645_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	5.18E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	1.81E-12	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	2.07E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	6.93E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	6.49E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	5.53E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317235751	NA	2.05E-10	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251