\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317164649:

Variant ID: vg0317164649 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17164649
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TCGAGATCGTTCTCGATAATGGGGTGTACTCGACCACAACCTACTTAAGTGCTCAATTGTTCCTGAAAAATATTTTCTAGAAGGCAAGACATATAGCAGA[A/G,T]
AATATCGAGTATGTACTCAAAAAACTGCATGGATCTTCTAGCATTATCAGGATATAATGAGCAGATATAAATATCAGGCATTATGTAGACCGTAAACAAG

Reverse complement sequence

CTTGTTTACGGTCTACATAATGCCTGATATTTATATCTGCTCATTATATCCTGATAATGCTAGAAGATCCATGCAGTTTTTTGAGTACATACTCGATATT[T/C,A]
TCTGCTATATGTCTTGCCTTCTAGAAAATATTTTTCAGGAACAATTGAGCACTTAAGTAGGTTGTGGTCGAGTACACCCCATTATCGAGAACGATCTCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 33.30% 0.21% 0.08% NA
All Indica  2759 94.70% 5.00% 0.22% 0.07% NA
All Japonica  1512 7.70% 92.20% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 1.00% 0.50% 0.00% NA
Indica II  465 90.10% 9.50% 0.22% 0.22% NA
Indica III  913 94.40% 5.60% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 4.60% 0.25% 0.13% NA
Temperate Japonica  767 4.70% 95.30% 0.00% 0.00% NA
Tropical Japonica  504 12.30% 87.30% 0.40% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 60.00% 35.60% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317164649 A -> T LOC_Os03g30084.1 downstream_gene_variant ; 4445.0bp to feature; MODIFIER N Average:45.079; most accessible tissue: Minghui63 flower, score: 61.616 N N N N
vg0317164649 A -> T LOC_Os03g30088.1 intron_variant ; MODIFIER N Average:45.079; most accessible tissue: Minghui63 flower, score: 61.616 N N N N
vg0317164649 A -> DEL N N silent_mutation Average:45.079; most accessible tissue: Minghui63 flower, score: 61.616 N N N N
vg0317164649 A -> G LOC_Os03g30084.1 downstream_gene_variant ; 4445.0bp to feature; MODIFIER silent_mutation Average:45.079; most accessible tissue: Minghui63 flower, score: 61.616 N N N N
vg0317164649 A -> G LOC_Os03g30088.1 intron_variant ; MODIFIER silent_mutation Average:45.079; most accessible tissue: Minghui63 flower, score: 61.616 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317164649 NA 7.03E-12 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317164649 NA 4.33E-13 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 NA 5.49E-13 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 NA 8.90E-13 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 3.86E-06 4.77E-14 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 NA 1.53E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 NA 1.06E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 NA 1.01E-13 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 1.48E-07 2.58E-13 mr1132 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 2.50E-07 5.34E-15 mr1142 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 8.68E-09 1.43E-10 mr1334 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 1.26E-06 9.10E-14 mr1390 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 7.77E-08 9.11E-12 mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 4.48E-06 4.56E-13 mr1490 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 5.93E-08 1.96E-15 mr1491 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 4.81E-07 2.81E-09 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 2.65E-06 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 1.36E-09 8.55E-12 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 NA 4.85E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 NA 1.06E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 NA 1.69E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317164649 NA 5.73E-33 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251