\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317038125:

Variant ID: vg0317038125 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17038125
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAATAGGAGGTTTCCAAAATATGTGGGTTTTTTGTTGCAATGAAATATTTCAGTTCACTACAACATTAGATCTATACATAGTGGAATATTGTGAGTGCA[C/T]
TAGGTGAAACATTTTTTGCGGAACAAAAAATAAACCAAATTCCCTTAATAGAGGGTTTCCAAAATATGTGGGTGATTTATTGCAACGGCGTGTTCCACTG

Reverse complement sequence

CAGTGGAACACGCCGTTGCAATAAATCACCCACATATTTTGGAAACCCTCTATTAAGGGAATTTGGTTTATTTTTTGTTCCGCAAAAAATGTTTCACCTA[G/A]
TGCACTCACAATATTCCACTATGTATAGATCTAATGTTGTAGTGAACTGAAATATTTCATTGCAACAAAAAACCCACATATTTTGGAAACCTCCTATTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 3.70% 0.02% 0.34% NA
All Indica  2759 100.00% 0.00% 0.00% 0.04% NA
All Japonica  1512 88.40% 11.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 78.20% 21.60% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 1.00% 0.00% 14.58% NA
Intermediate  90 97.80% 1.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317038125 C -> T LOC_Os03g29900.1 upstream_gene_variant ; 2899.0bp to feature; MODIFIER silent_mutation Average:41.057; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg0317038125 C -> T LOC_Os03g29910.1 upstream_gene_variant ; 1173.0bp to feature; MODIFIER silent_mutation Average:41.057; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg0317038125 C -> T LOC_Os03g29910.2 upstream_gene_variant ; 1173.0bp to feature; MODIFIER silent_mutation Average:41.057; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg0317038125 C -> T LOC_Os03g29900-LOC_Os03g29910 intergenic_region ; MODIFIER silent_mutation Average:41.057; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg0317038125 C -> DEL N N silent_mutation Average:41.057; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317038125 4.25E-10 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 4.75E-08 8.61E-12 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 1.33E-08 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 1.05E-06 1.56E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 2.06E-06 2.06E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 1.13E-08 4.61E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 2.74E-07 4.48E-12 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 2.72E-11 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 3.10E-08 9.55E-12 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 5.41E-06 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 NA 1.46E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 NA 1.08E-06 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 8.70E-08 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 8.76E-07 5.25E-10 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 2.80E-06 4.33E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 8.02E-07 8.41E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 2.47E-09 2.53E-11 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 1.02E-06 4.64E-12 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 NA 4.35E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 2.24E-07 NA mr1793_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125 1.38E-06 1.83E-09 mr1793_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251