Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317038125:

Variant ID: vg0317038125 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17038125
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAATAGGAGGTTTCCAAAATATGTGGGTTTTTTGTTGCAATGAAATATTTCAGTTCACTACAACATTAGATCTATACATAGTGGAATATTGTGAGTGCA[C/T]
TAGGTGAAACATTTTTTGCGGAACAAAAAATAAACCAAATTCCCTTAATAGAGGGTTTCCAAAATATGTGGGTGATTTATTGCAACGGCGTGTTCCACTG

Reverse complement sequence

CAGTGGAACACGCCGTTGCAATAAATCACCCACATATTTTGGAAACCCTCTATTAAGGGAATTTGGTTTATTTTTTGTTCCGCAAAAAATGTTTCACCTA[G/A]
TGCACTCACAATATTCCACTATGTATAGATCTAATGTTGTAGTGAACTGAAATATTTCATTGCAACAAAAAACCCACATATTTTGGAAACCTCCTATTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.90%	3.70%	0.02%	0.34%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.04%	NA
All Japonica	1512	88.40%	11.50%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	78.20%	21.60%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	84.40%	1.00%	0.00%	14.58%	NA
Intermediate	90	97.80%	1.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317038125	C -> T	LOC_Os03g29900.1	upstream_gene_variant ; 2899.0bp to feature; MODIFIER	silent_mutation	Average:41.057; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0317038125	C -> T	LOC_Os03g29910.1	upstream_gene_variant ; 1173.0bp to feature; MODIFIER	silent_mutation	Average:41.057; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0317038125	C -> T	LOC_Os03g29910.2	upstream_gene_variant ; 1173.0bp to feature; MODIFIER	silent_mutation	Average:41.057; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0317038125	C -> T	LOC_Os03g29900-LOC_Os03g29910	intergenic_region ; MODIFIER	silent_mutation	Average:41.057; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0317038125	C -> DEL	N	N	silent_mutation	Average:41.057; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317038125	4.25E-10	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	4.75E-08	8.61E-12	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	1.33E-08	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	1.05E-06	1.56E-09	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	2.06E-06	2.06E-06	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	1.13E-08	4.61E-09	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	2.74E-07	4.48E-12	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	2.72E-11	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	3.10E-08	9.55E-12	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	5.41E-06	NA	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	NA	1.46E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	NA	1.08E-06	mr1793	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	8.70E-08	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	8.76E-07	5.25E-10	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	2.80E-06	4.33E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	8.02E-07	8.41E-07	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	2.47E-09	2.53E-11	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	1.02E-06	4.64E-12	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	NA	4.35E-06	mr1703_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	2.24E-07	NA	mr1793_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317038125	1.38E-06	1.83E-09	mr1793_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251