Variant ID: vg0317031987 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 17031987 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 103. )
TTTTACACCAGTATTTTCTTGAGACCATTTACAACTTCAATTTAGGCTTGGGAAAGAACTTCAGGGTGTGACACAACTCATCTAATCTCTTCCAAAGCTC[A/G]
TTGAATTTTTTCTCCTGGTTCTGATTGCATAGCCTCTTGAATATGTTCATGAGCTCCTTGTTCTTGAATTGCTTGAAGAAATCAGCTCCCATATGATGCA
TGCATCATATGGGAGCTGATTTCTTCAAGCAATTCAAGAACAAGGAGCTCATGAACATATTCAAGAGGCTATGCAATCAGAACCAGGAGAAAAAATTCAA[T/C]
GAGCTTTGGAAGAGATTAGATGAGTTGTGTCACACCCTGAAGTTCTTTCCCAAGCCTAAATTGAAGTTGTAAATGGTCTCAAGAAAATACTGGTGTAAAA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 51.30% | 46.90% | 0.19% | 1.61% | NA |
All Indica | 2759 | 21.70% | 77.90% | 0.22% | 0.18% | NA |
All Japonica | 1512 | 99.30% | 0.50% | 0.07% | 0.13% | NA |
Aus | 269 | 92.90% | 6.70% | 0.00% | 0.37% | NA |
Indica I | 595 | 5.70% | 94.10% | 0.17% | 0.00% | NA |
Indica II | 465 | 15.30% | 84.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 32.30% | 67.00% | 0.22% | 0.44% | NA |
Indica Intermediate | 786 | 25.40% | 74.00% | 0.38% | 0.13% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 98.60% | 1.20% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 98.80% | 0.40% | 0.00% | 0.83% | NA |
VI/Aromatic | 96 | 22.90% | 9.40% | 2.08% | 65.62% | NA |
Intermediate | 90 | 57.80% | 36.70% | 0.00% | 5.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0317031987 | A -> DEL | LOC_Os03g29900.1 | N | frameshift_variant | Average:37.959; most accessible tissue: Minghui63 flower, score: 51.629 | N | N | N | N |
vg0317031987 | A -> G | LOC_Os03g29900.1 | synonymous_variant ; p.Asn641Asn; LOW | synonymous_codon | Average:37.959; most accessible tissue: Minghui63 flower, score: 51.629 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0317031987 | NA | 5.90E-37 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0317031987 | 3.16E-06 | 5.91E-07 | mr1063 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0317031987 | 6.05E-06 | NA | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0317031987 | NA | 8.13E-37 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0317031987 | NA | 1.03E-13 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0317031987 | NA | 2.66E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0317031987 | NA | 1.83E-13 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0317031987 | NA | 4.03E-06 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0317031987 | NA | 2.36E-09 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0317031987 | NA | 1.08E-15 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |