\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317031987:

Variant ID: vg0317031987 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17031987
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTACACCAGTATTTTCTTGAGACCATTTACAACTTCAATTTAGGCTTGGGAAAGAACTTCAGGGTGTGACACAACTCATCTAATCTCTTCCAAAGCTC[A/G]
TTGAATTTTTTCTCCTGGTTCTGATTGCATAGCCTCTTGAATATGTTCATGAGCTCCTTGTTCTTGAATTGCTTGAAGAAATCAGCTCCCATATGATGCA

Reverse complement sequence

TGCATCATATGGGAGCTGATTTCTTCAAGCAATTCAAGAACAAGGAGCTCATGAACATATTCAAGAGGCTATGCAATCAGAACCAGGAGAAAAAATTCAA[T/C]
GAGCTTTGGAAGAGATTAGATGAGTTGTGTCACACCCTGAAGTTCTTTCCCAAGCCTAAATTGAAGTTGTAAATGGTCTCAAGAAAATACTGGTGTAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 46.90% 0.19% 1.61% NA
All Indica  2759 21.70% 77.90% 0.22% 0.18% NA
All Japonica  1512 99.30% 0.50% 0.07% 0.13% NA
Aus  269 92.90% 6.70% 0.00% 0.37% NA
Indica I  595 5.70% 94.10% 0.17% 0.00% NA
Indica II  465 15.30% 84.70% 0.00% 0.00% NA
Indica III  913 32.30% 67.00% 0.22% 0.44% NA
Indica Intermediate  786 25.40% 74.00% 0.38% 0.13% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.20% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 22.90% 9.40% 2.08% 65.62% NA
Intermediate  90 57.80% 36.70% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317031987 A -> DEL LOC_Os03g29900.1 N frameshift_variant Average:37.959; most accessible tissue: Minghui63 flower, score: 51.629 N N N N
vg0317031987 A -> G LOC_Os03g29900.1 synonymous_variant ; p.Asn641Asn; LOW synonymous_codon Average:37.959; most accessible tissue: Minghui63 flower, score: 51.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317031987 NA 5.90E-37 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317031987 3.16E-06 5.91E-07 mr1063 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317031987 6.05E-06 NA mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317031987 NA 8.13E-37 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317031987 NA 1.03E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317031987 NA 2.66E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317031987 NA 1.83E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317031987 NA 4.03E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317031987 NA 2.36E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317031987 NA 1.08E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251