\
| Variant ID: vg0317014991 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17014991 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACACGGTCAGAACGACCTTTATCAGCCTTGTTCTTCATACGCAGCTGGGCTCGAGTTAACTGCTGCTGTAAAAATTCAGACAAGTGCTGCCTTTCAGTCT[A/G]
AACATCCACCACATCAGGCAGAGTAGCCAATGTCAGATCAGGAACTTGAGAATAATGAGGATCCACCCCAAAAAGAGCCTTATGAGGAGAACAGCCAAGA
TCTTGGCTGTTCTCCTCATAAGGCTCTTTTTGGGGTGGATCCTCATTATTCTCAAGTTCCTGATCTGACATTGGCTACTCTGCCTGATGTGGTGGATGTT[T/C]
AGACTGAAAGGCAGCACTTGTCTGAATTTTTACAGCAGCAGTTAACTCGAGCCCAGCTGCGTATGAAGAACAAGGCTGATAAAGGTCGTTCTGACCGTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 0.10% | 3.83% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.60% | 0.50% | 11.90% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 81.00% | 0.90% | 18.12% | 0.00% | NA |
| Tropical Japonica | 504 | 92.90% | 0.00% | 7.14% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317014991 | A -> G | LOC_Os03g29850.1 | upstream_gene_variant ; 3728.0bp to feature; MODIFIER | silent_mutation | Average:23.182; most accessible tissue: Minghui63 flower, score: 39.692 | N | N | N | N |
| vg0317014991 | A -> G | LOC_Os03g29864.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.182; most accessible tissue: Minghui63 flower, score: 39.692 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317014991 | 5.01E-06 | NA | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317014991 | NA | 2.09E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317014991 | NA | 2.67E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317014991 | NA | 4.10E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317014991 | 1.21E-06 | NA | mr1897 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317014991 | NA | 4.39E-07 | mr1897 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317014991 | NA | 2.05E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317014991 | NA | 1.66E-06 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |