\
| Variant ID: vg0316518526 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16518526 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 250. )
GCCACGCGATCGAAGACGATCTACATGCGTTAACACAAAATCCGGGCGAATCCTTGAGGGACTATGTATGACGCTTTAATGAGTGTAGAAATACAATCCC[T/C]
GAAATCACCGACGCCTCTGTGATTCGCGCTTTCAAAATCGGTGTCAGAGATCGCTATACTACCCAGGAGTTGGCAACAAGTCGAATCACAACTACTCGAA
TTCGAGTAGTTGTGATTCGACTTGTTGCCAACTCCTGGGTAGTATAGCGATCTCTGACACCGATTTTGAAAGCGCGAATCACAGAGGCGTCGGTGATTTC[A/G]
GGGATTGTATTTCTACACTCATTAAAGCGTCATACATAGTCCCTCAAGGATTCGCCCGGATTTTGTGTTAACGCATGTAGATCGTCTTCGATCGCGTGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 24.10% | 0.66% | 12.59% | NA |
| All Indica | 2759 | 79.20% | 15.50% | 0.18% | 5.11% | NA |
| All Japonica | 1512 | 33.20% | 39.90% | 1.52% | 25.33% | NA |
| Aus | 269 | 76.60% | 1.50% | 0.74% | 21.19% | NA |
| Indica I | 595 | 62.40% | 37.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.30% | 5.60% | 0.43% | 1.72% | NA |
| Indica III | 913 | 84.20% | 8.50% | 0.00% | 7.23% | NA |
| Indica Intermediate | 786 | 78.40% | 12.70% | 0.38% | 8.52% | NA |
| Temperate Japonica | 767 | 7.30% | 50.50% | 2.35% | 39.90% | NA |
| Tropical Japonica | 504 | 66.30% | 25.60% | 0.40% | 7.74% | NA |
| Japonica Intermediate | 241 | 46.50% | 36.50% | 1.24% | 15.77% | NA |
| VI/Aromatic | 96 | 12.50% | 83.30% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 64.40% | 23.30% | 1.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316518526 | T -> C | LOC_Os03g29075.1 | synonymous_variant ; p.Pro547Pro; LOW | synonymous_codon | Average:57.187; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0316518526 | T -> DEL | LOC_Os03g29075.1 | N | frameshift_variant | Average:57.187; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316518526 | NA | 2.02E-06 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | NA | 1.91E-07 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | NA | 9.90E-08 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | 8.74E-06 | 8.74E-06 | mr1547_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | NA | 4.06E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | 6.01E-06 | 6.01E-06 | mr1719_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | NA | 2.82E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | 3.90E-06 | 1.01E-08 | mr1780_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | NA | 7.19E-06 | mr1844_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | 6.82E-06 | 6.82E-06 | mr1895_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | 4.23E-06 | 4.23E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316518526 | 2.49E-06 | 2.49E-06 | mr1981_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |