\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316453911:

Variant ID: vg0316453911 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16453911
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATGAAGGAATAGAAAAAACGCAGGATTCTAATAAAAATGTAAGTGCAAAACAAAAGATTGCAAAATATAAGAAAAACACAGGAATGATCGTTTGATT[G/A]
GACCGCAGGAAAAACGTATGAATCGGATGTGAGAGATAGAGATGAGAGAGATAGACTCAAAAGGAAGTTTCCAAAAGGTTGAAGCTCTCGCTAATTTCCT

Reverse complement sequence

AGGAAATTAGCGAGAGCTTCAACCTTTTGGAAACTTCCTTTTGAGTCTATCTCTCTCATCTCTATCTCTCACATCCGATTCATACGTTTTTCCTGCGGTC[C/T]
AATCAAACGATCATTCCTGTGTTTTTCTTATATTTTGCAATCTTTTGTTTTGCACTTACATTTTTATTAGAATCCTGCGTTTTTTCTATTCCTTCATTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 30.70% 0.38% 12.12% NA
All Indica  2759 75.60% 21.10% 0.43% 2.90% NA
All Japonica  1512 22.70% 49.30% 0.40% 27.65% NA
Aus  269 72.50% 5.20% 0.00% 22.30% NA
Indica I  595 59.80% 39.70% 0.50% 0.00% NA
Indica II  465 92.50% 5.40% 0.43% 1.72% NA
Indica III  913 78.00% 19.70% 0.11% 2.19% NA
Indica Intermediate  786 74.80% 17.80% 0.76% 6.62% NA
Temperate Japonica  767 1.00% 55.00% 0.65% 43.29% NA
Tropical Japonica  504 61.90% 29.20% 0.20% 8.73% NA
Japonica Intermediate  241 9.50% 73.00% 0.00% 17.43% NA
VI/Aromatic  96 8.30% 87.50% 0.00% 4.17% NA
Intermediate  90 56.70% 31.10% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316453911 G -> A LOC_Os03g28990.1 upstream_gene_variant ; 3607.0bp to feature; MODIFIER silent_mutation Average:50.295; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0316453911 G -> A LOC_Os03g28990.2 upstream_gene_variant ; 3607.0bp to feature; MODIFIER silent_mutation Average:50.295; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0316453911 G -> A LOC_Os03g28980.1 downstream_gene_variant ; 1943.0bp to feature; MODIFIER silent_mutation Average:50.295; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0316453911 G -> A LOC_Os03g28980-LOC_Os03g28990 intergenic_region ; MODIFIER silent_mutation Average:50.295; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0316453911 G -> DEL N N silent_mutation Average:50.295; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316453911 NA 2.77E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911 4.47E-06 4.47E-06 mr1452_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911 NA 1.56E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911 1.77E-07 1.77E-07 mr1470_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911 NA 4.09E-07 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911 1.68E-07 1.68E-07 mr1719_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911 NA 5.61E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911 1.82E-06 1.82E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911 4.07E-06 4.07E-06 mr1927_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251