Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0316453911:

Variant ID: vg0316453911 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16453911
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATGAAGGAATAGAAAAAACGCAGGATTCTAATAAAAATGTAAGTGCAAAACAAAAGATTGCAAAATATAAGAAAAACACAGGAATGATCGTTTGATT[G/A]
GACCGCAGGAAAAACGTATGAATCGGATGTGAGAGATAGAGATGAGAGAGATAGACTCAAAAGGAAGTTTCCAAAAGGTTGAAGCTCTCGCTAATTTCCT

Reverse complement sequence

AGGAAATTAGCGAGAGCTTCAACCTTTTGGAAACTTCCTTTTGAGTCTATCTCTCTCATCTCTATCTCTCACATCCGATTCATACGTTTTTCCTGCGGTC[C/T]
AATCAAACGATCATTCCTGTGTTTTTCTTATATTTTGCAATCTTTTGTTTTGCACTTACATTTTTATTAGAATCCTGCGTTTTTTCTATTCCTTCATTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.80%	30.70%	0.38%	12.12%	NA
All Indica	2759	75.60%	21.10%	0.43%	2.90%	NA
All Japonica	1512	22.70%	49.30%	0.40%	27.65%	NA
Aus	269	72.50%	5.20%	0.00%	22.30%	NA
Indica I	595	59.80%	39.70%	0.50%	0.00%	NA
Indica II	465	92.50%	5.40%	0.43%	1.72%	NA
Indica III	913	78.00%	19.70%	0.11%	2.19%	NA
Indica Intermediate	786	74.80%	17.80%	0.76%	6.62%	NA
Temperate Japonica	767	1.00%	55.00%	0.65%	43.29%	NA
Tropical Japonica	504	61.90%	29.20%	0.20%	8.73%	NA
Japonica Intermediate	241	9.50%	73.00%	0.00%	17.43%	NA
VI/Aromatic	96	8.30%	87.50%	0.00%	4.17%	NA
Intermediate	90	56.70%	31.10%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316453911	G -> A	LOC_Os03g28990.1	upstream_gene_variant ; 3607.0bp to feature; MODIFIER	silent_mutation	Average:50.295; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0316453911	G -> A	LOC_Os03g28990.2	upstream_gene_variant ; 3607.0bp to feature; MODIFIER	silent_mutation	Average:50.295; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0316453911	G -> A	LOC_Os03g28980.1	downstream_gene_variant ; 1943.0bp to feature; MODIFIER	silent_mutation	Average:50.295; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0316453911	G -> A	LOC_Os03g28980-LOC_Os03g28990	intergenic_region ; MODIFIER	silent_mutation	Average:50.295; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0316453911	G -> DEL	N	N	silent_mutation	Average:50.295; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316453911	NA	2.77E-06	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911	4.47E-06	4.47E-06	mr1452_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911	NA	1.56E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911	1.77E-07	1.77E-07	mr1470_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911	NA	4.09E-07	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911	1.68E-07	1.68E-07	mr1719_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911	NA	5.61E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911	1.82E-06	1.82E-06	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316453911	4.07E-06	4.07E-06	mr1927_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251