\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316411183:

Variant ID: vg0316411183 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16411183
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCCTAATGAGATAAATCAATTGTTAATCTTATATGTCCATAAGAGGAATTTGGGTACTTTTGAAAAGAAGACATATCCCAATGGCGTATTGATGAAC[G/A]
ATTGATAAAGTCGTTGGTATATAATATAAATCGACAATGTCGATGGTAAATCGTTGAACTCGAACAAACTCAATTGTATAGAATAGATTCTCTCTAGGAT

Reverse complement sequence

ATCCTAGAGAGAATCTATTCTATACAATTGAGTTTGTTCGAGTTCAACGATTTACCATCGACATTGTCGATTTATATTATATACCAACGACTTTATCAAT[C/T]
GTTCATCAATACGCCATTGGGATATGTCTTCTTTTCAAAAGTACCCAAATTCCTCTTATGGACATATAAGATTAACAATTGATTTATCTCATTAGGAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.00% 23.90% 0.15% 0.00% NA
All Indica  2759 84.20% 15.50% 0.22% 0.00% NA
All Japonica  1512 60.50% 39.40% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 62.40% 37.60% 0.00% 0.00% NA
Indica II  465 94.40% 5.40% 0.22% 0.00% NA
Indica III  913 91.30% 8.50% 0.11% 0.00% NA
Indica Intermediate  786 86.50% 13.00% 0.51% 0.00% NA
Temperate Japonica  767 50.50% 49.40% 0.13% 0.00% NA
Tropical Japonica  504 74.20% 25.80% 0.00% 0.00% NA
Japonica Intermediate  241 63.90% 36.10% 0.00% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316411183 G -> A LOC_Os03g28940.1 upstream_gene_variant ; 1103.0bp to feature; MODIFIER silent_mutation Average:59.18; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0316411183 G -> A LOC_Os03g28940.2 upstream_gene_variant ; 1641.0bp to feature; MODIFIER silent_mutation Average:59.18; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0316411183 G -> A LOC_Os03g28940-LOC_Os03g28950 intergenic_region ; MODIFIER silent_mutation Average:59.18; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316411183 NA 7.50E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 NA 2.24E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 1.03E-06 1.03E-06 mr1470_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 NA 3.59E-07 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 3.15E-06 3.15E-06 mr1681_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 5.37E-07 5.36E-07 mr1719_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 NA 2.90E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 NA 3.10E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 NA 2.51E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 NA 4.29E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 NA 4.47E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 3.30E-07 3.30E-07 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183 7.73E-07 7.73E-07 mr1927_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251