Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316411183:

Variant ID: vg0316411183 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16411183
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

AACTCCTAATGAGATAAATCAATTGTTAATCTTATATGTCCATAAGAGGAATTTGGGTACTTTTGAAAAGAAGACATATCCCAATGGCGTATTGATGAAC[G/A]
ATTGATAAAGTCGTTGGTATATAATATAAATCGACAATGTCGATGGTAAATCGTTGAACTCGAACAAACTCAATTGTATAGAATAGATTCTCTCTAGGAT

Reverse complement sequence

ATCCTAGAGAGAATCTATTCTATACAATTGAGTTTGTTCGAGTTCAACGATTTACCATCGACATTGTCGATTTATATTATATACCAACGACTTTATCAAT[C/T]
GTTCATCAATACGCCATTGGGATATGTCTTCTTTTCAAAAGTACCCAAATTCCTCTTATGGACATATAAGATTAACAATTGATTTATCTCATTAGGAGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.00%	23.90%	0.15%	0.00%	NA
All Indica	2759	84.20%	15.50%	0.22%	0.00%	NA
All Japonica	1512	60.50%	39.40%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	62.40%	37.60%	0.00%	0.00%	NA
Indica II	465	94.40%	5.40%	0.22%	0.00%	NA
Indica III	913	91.30%	8.50%	0.11%	0.00%	NA
Indica Intermediate	786	86.50%	13.00%	0.51%	0.00%	NA
Temperate Japonica	767	50.50%	49.40%	0.13%	0.00%	NA
Tropical Japonica	504	74.20%	25.80%	0.00%	0.00%	NA
Japonica Intermediate	241	63.90%	36.10%	0.00%	0.00%	NA
VI/Aromatic	96	16.70%	83.30%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316411183	G -> A	LOC_Os03g28940.1	upstream_gene_variant ; 1103.0bp to feature; MODIFIER	silent_mutation	Average:59.18; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0316411183	G -> A	LOC_Os03g28940.2	upstream_gene_variant ; 1641.0bp to feature; MODIFIER	silent_mutation	Average:59.18; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0316411183	G -> A	LOC_Os03g28940-LOC_Os03g28950	intergenic_region ; MODIFIER	silent_mutation	Average:59.18; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316411183	NA	7.50E-06	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	NA	2.24E-07	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	1.03E-06	1.03E-06	mr1470_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	NA	3.59E-07	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	3.15E-06	3.15E-06	mr1681_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	5.37E-07	5.36E-07	mr1719_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	NA	2.90E-06	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	NA	3.10E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	NA	2.51E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	NA	4.29E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	NA	4.47E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	3.30E-07	3.30E-07	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316411183	7.73E-07	7.73E-07	mr1927_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251