\
| Variant ID: vg0316147114 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16147114 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTTTTTAATTGGATGTGACTACACAGCTAGTGGTAGCTAGTTTGTACTCCATTTAGTATCTCCTTTCAACTTGAAAAATACAATAGTATCTTCTTTTCT[C/G]
ATTCTACATGAAAAACAAAAGTGAAAGGAAAAAAACAATCGATGATTAAACAGATTTATAGAGAGTTACTTTTGAACCATGCAAAAGTTACTTCCAATTA
TAATTGGAAGTAACTTTTGCATGGTTCAAAAGTAACTCTCTATAAATCTGTTTAATCATCGATTGTTTTTTTCCTTTCACTTTTGTTTTTCATGTAGAAT[G/C]
AGAAAAGAAGATACTATTGTATTTTTCAAGTTGAAAGGAGATACTAAATGGAGTACAAACTAGCTACCACTAGCTGTGTAGTCACATCCAATTAAAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 4.90% | 0.53% | 0.11% | NA |
| All Indica | 2759 | 97.30% | 2.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.10% | 0.33% | 0.33% | NA |
| Aus | 269 | 38.30% | 56.90% | 4.83% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.20% | 3.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 4.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 0.10% | 0.65% | 0.52% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316147114 | C -> DEL | N | N | silent_mutation | Average:16.104; most accessible tissue: Minghui63 flag leaf, score: 23.047 | N | N | N | N |
| vg0316147114 | C -> G | LOC_Os03g28090.1 | upstream_gene_variant ; 4110.0bp to feature; MODIFIER | silent_mutation | Average:16.104; most accessible tissue: Minghui63 flag leaf, score: 23.047 | N | N | N | N |
| vg0316147114 | C -> G | LOC_Os03g28080-LOC_Os03g28090 | intergenic_region ; MODIFIER | silent_mutation | Average:16.104; most accessible tissue: Minghui63 flag leaf, score: 23.047 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316147114 | NA | 1.44E-15 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 4.43E-06 | 1.56E-20 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 1.54E-06 | 1.16E-18 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 6.69E-06 | 4.70E-21 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 2.76E-07 | NA | mr1118 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | NA | 4.20E-17 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 5.92E-09 | 3.12E-28 | mr1123 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | NA | 5.00E-18 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 6.60E-09 | 1.25E-22 | mr1242 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 4.79E-06 | 9.60E-23 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 3.88E-06 | 1.69E-16 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 2.32E-07 | 1.44E-28 | mr1858 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 2.22E-07 | 1.32E-28 | mr1859 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 4.95E-07 | 1.46E-20 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 1.20E-06 | 5.75E-19 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 3.08E-06 | 2.19E-20 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 3.35E-07 | NA | mr1118_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 1.32E-06 | 1.26E-19 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 1.21E-08 | 2.31E-25 | mr1123_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 1.76E-07 | 2.60E-21 | mr1240_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 9.09E-09 | NA | mr1242_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 8.65E-07 | 9.74E-24 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 2.31E-06 | NA | mr1495_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 1.29E-07 | 2.03E-15 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | 5.57E-07 | 9.03E-18 | mr1936_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316147114 | NA | 2.33E-16 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |