\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316147114:

Variant ID: vg0316147114 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16147114
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTAATTGGATGTGACTACACAGCTAGTGGTAGCTAGTTTGTACTCCATTTAGTATCTCCTTTCAACTTGAAAAATACAATAGTATCTTCTTTTCT[C/G]
ATTCTACATGAAAAACAAAAGTGAAAGGAAAAAAACAATCGATGATTAAACAGATTTATAGAGAGTTACTTTTGAACCATGCAAAAGTTACTTCCAATTA

Reverse complement sequence

TAATTGGAAGTAACTTTTGCATGGTTCAAAAGTAACTCTCTATAAATCTGTTTAATCATCGATTGTTTTTTTCCTTTCACTTTTGTTTTTCATGTAGAAT[G/C]
AGAAAAGAAGATACTATTGTATTTTTCAAGTTGAAAGGAGATACTAAATGGAGTACAAACTAGCTACCACTAGCTGTGTAGTCACATCCAATTAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 4.90% 0.53% 0.11% NA
All Indica  2759 97.30% 2.50% 0.18% 0.00% NA
All Japonica  1512 99.30% 0.10% 0.33% 0.33% NA
Aus  269 38.30% 56.90% 4.83% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 96.20% 3.50% 0.33% 0.00% NA
Indica Intermediate  786 95.00% 4.70% 0.25% 0.00% NA
Temperate Japonica  767 98.70% 0.10% 0.65% 0.52% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316147114 C -> DEL N N silent_mutation Average:16.104; most accessible tissue: Minghui63 flag leaf, score: 23.047 N N N N
vg0316147114 C -> G LOC_Os03g28090.1 upstream_gene_variant ; 4110.0bp to feature; MODIFIER silent_mutation Average:16.104; most accessible tissue: Minghui63 flag leaf, score: 23.047 N N N N
vg0316147114 C -> G LOC_Os03g28080-LOC_Os03g28090 intergenic_region ; MODIFIER silent_mutation Average:16.104; most accessible tissue: Minghui63 flag leaf, score: 23.047 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316147114 NA 1.44E-15 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 4.43E-06 1.56E-20 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 1.54E-06 1.16E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 6.69E-06 4.70E-21 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 2.76E-07 NA mr1118 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 NA 4.20E-17 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 5.92E-09 3.12E-28 mr1123 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 NA 5.00E-18 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 6.60E-09 1.25E-22 mr1242 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 4.79E-06 9.60E-23 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 3.88E-06 1.69E-16 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 2.32E-07 1.44E-28 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 2.22E-07 1.32E-28 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 4.95E-07 1.46E-20 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 1.20E-06 5.75E-19 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 3.08E-06 2.19E-20 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 3.35E-07 NA mr1118_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 1.32E-06 1.26E-19 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 1.21E-08 2.31E-25 mr1123_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 1.76E-07 2.60E-21 mr1240_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 9.09E-09 NA mr1242_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 8.65E-07 9.74E-24 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 2.31E-06 NA mr1495_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 1.29E-07 2.03E-15 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 5.57E-07 9.03E-18 mr1936_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316147114 NA 2.33E-16 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251