Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0316108526:

Variant ID: vg0316108526 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16108526
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

AATCCTACAAGAGGGCCTGACCAGCCGAAGCGTCACGTGGTTCTCCCAGGCAAAAGAAAAATCGTAGGAGGTGAGGACAAGACTGACGAGGATTACGATC[A/T]
GTTGGATGGGCAACCCCCTTTCACGGTGACGATTGAGCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGTAGCGATCACAAGGAGGGAACA

Reverse complement sequence

TGTTCCCTCCTTGTGATCGCTACGTGAGTAAGGGGTGTCTTCATTTGATAGGAGGATGCTAGGCTCAATCGTCACCGTGAAAGGGGGTTGCCCATCCAAC[T/A]
GATCGTAATCCTCGTCAGTCTTGTCCTCACCTCCTACGATTTTTCTTTTGCCTGGGAGAACCACGTGACGCTTCGGCTGGTCAGGCCCTCTTGTAGGATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	49.10%	0.19%	0.00%	NA
All Indica	2759	19.10%	80.60%	0.29%	0.00%	NA
All Japonica	1512	97.00%	3.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	15.00%	84.90%	0.17%	0.00%	NA
Indica II	465	9.20%	90.10%	0.65%	0.00%	NA
Indica III	913	25.80%	73.90%	0.22%	0.00%	NA
Indica Intermediate	786	20.20%	79.50%	0.25%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	92.50%	7.50%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316108526	A -> T	LOC_Os03g28020.1	missense_variant ; p.Gln489Leu; MODERATE	nonsynonymous_codon ; Q489L	Average:38.745; most accessible tissue: Zhenshan97 panicle, score: 52.263	benign	0.297	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316108526	NA	6.48E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316108526	NA	4.79E-19	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316108526	NA	4.16E-13	mr1581	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316108526	NA	2.83E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316108526	NA	3.37E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316108526	NA	1.92E-07	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316108526	NA	1.96E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316108526	NA	5.24E-49	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316108526	NA	2.61E-15	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251