\
| Variant ID: vg0316108526 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16108526 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 245. )
AATCCTACAAGAGGGCCTGACCAGCCGAAGCGTCACGTGGTTCTCCCAGGCAAAAGAAAAATCGTAGGAGGTGAGGACAAGACTGACGAGGATTACGATC[A/T]
GTTGGATGGGCAACCCCCTTTCACGGTGACGATTGAGCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGTAGCGATCACAAGGAGGGAACA
TGTTCCCTCCTTGTGATCGCTACGTGAGTAAGGGGTGTCTTCATTTGATAGGAGGATGCTAGGCTCAATCGTCACCGTGAAAGGGGGTTGCCCATCCAAC[T/A]
GATCGTAATCCTCGTCAGTCTTGTCCTCACCTCCTACGATTTTTCTTTTGCCTGGGAGAACCACGTGACGCTTCGGCTGGTCAGGCCCTCTTGTAGGATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.70% | 49.10% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 19.10% | 80.60% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 15.00% | 84.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 9.20% | 90.10% | 0.65% | 0.00% | NA |
| Indica III | 913 | 25.80% | 73.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 20.20% | 79.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316108526 | A -> T | LOC_Os03g28020.1 | missense_variant ; p.Gln489Leu; MODERATE | nonsynonymous_codon ; Q489L | Average:38.745; most accessible tissue: Zhenshan97 panicle, score: 52.263 | benign |
0.297 |
DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316108526 | NA | 6.48E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316108526 | NA | 4.79E-19 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316108526 | NA | 4.16E-13 | mr1581 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316108526 | NA | 2.83E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316108526 | NA | 3.37E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316108526 | NA | 1.92E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316108526 | NA | 1.96E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316108526 | NA | 5.24E-49 | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316108526 | NA | 2.61E-15 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |