\
| Variant ID: vg0315931790 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15931790 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 97. )
CCTTTTCTACACGAAAACGATTCCCGAATTGCTAAACGACGCGTCTTAAATTTTACTTCCTCCATTCTACGATGTAAGACTTTCTAGCATTGCCCACATT[T/C]
ATTTAGATGTTAATGAATCTAGACGTATGTATGTGTTTAGATTCATTAACATCTATATATATGTGAGCAATGCTAGAAAATCTTACATTGTGAAACGGTG
CACCGTTTCACAATGTAAGATTTTCTAGCATTGCTCACATATATATAGATGTTAATGAATCTAAACACATACATACGTCTAGATTCATTAACATCTAAAT[A/G]
AATGTGGGCAATGCTAGAAAGTCTTACATCGTAGAATGGAGGAAGTAAAATTTAAGACGCGTCGTTTAGCAATTCGGGAATCGTTTTCGTGTAGAAAAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.70% | 34.20% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 85.20% | 14.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 28.30% | 71.50% | 0.20% | 0.00% | NA |
| Aus | 269 | 88.50% | 11.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.70% | 11.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 63.30% | 36.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.40% | 72.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315931790 | T -> C | LOC_Os03g27770.1 | upstream_gene_variant ; 4356.0bp to feature; MODIFIER | silent_mutation | Average:64.843; most accessible tissue: Callus, score: 88.732 | N | N | N | N |
| vg0315931790 | T -> C | LOC_Os03g27780.1 | upstream_gene_variant ; 734.0bp to feature; MODIFIER | silent_mutation | Average:64.843; most accessible tissue: Callus, score: 88.732 | N | N | N | N |
| vg0315931790 | T -> C | LOC_Os03g27780.2 | upstream_gene_variant ; 734.0bp to feature; MODIFIER | silent_mutation | Average:64.843; most accessible tissue: Callus, score: 88.732 | N | N | N | N |
| vg0315931790 | T -> C | LOC_Os03g27770-LOC_Os03g27780 | intergenic_region ; MODIFIER | silent_mutation | Average:64.843; most accessible tissue: Callus, score: 88.732 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315931790 | NA | 3.10E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315931790 | NA | 8.97E-09 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315931790 | NA | 5.41E-10 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315931790 | NA | 1.20E-07 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315931790 | 3.69E-06 | 3.32E-06 | mr1198_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315931790 | NA | 1.11E-06 | mr1552_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |