Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0315931790:

Variant ID: vg0315931790 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15931790
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTTTCTACACGAAAACGATTCCCGAATTGCTAAACGACGCGTCTTAAATTTTACTTCCTCCATTCTACGATGTAAGACTTTCTAGCATTGCCCACATT[T/C]
ATTTAGATGTTAATGAATCTAGACGTATGTATGTGTTTAGATTCATTAACATCTATATATATGTGAGCAATGCTAGAAAATCTTACATTGTGAAACGGTG

Reverse complement sequence

CACCGTTTCACAATGTAAGATTTTCTAGCATTGCTCACATATATATAGATGTTAATGAATCTAAACACATACATACGTCTAGATTCATTAACATCTAAAT[A/G]
AATGTGGGCAATGCTAGAAAGTCTTACATCGTAGAATGGAGGAAGTAAAATTTAAGACGCGTCGTTTAGCAATTCGGGAATCGTTTTCGTGTAGAAAAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.70%	34.20%	0.08%	0.00%	NA
All Indica	2759	85.20%	14.80%	0.00%	0.00%	NA
All Japonica	1512	28.30%	71.50%	0.20%	0.00%	NA
Aus	269	88.50%	11.20%	0.37%	0.00%	NA
Indica I	595	88.60%	11.40%	0.00%	0.00%	NA
Indica II	465	87.10%	12.90%	0.00%	0.00%	NA
Indica III	913	79.20%	20.80%	0.00%	0.00%	NA
Indica Intermediate	786	88.70%	11.30%	0.00%	0.00%	NA
Temperate Japonica	767	5.60%	94.40%	0.00%	0.00%	NA
Tropical Japonica	504	63.30%	36.30%	0.40%	0.00%	NA
Japonica Intermediate	241	27.40%	72.20%	0.41%	0.00%	NA
VI/Aromatic	96	26.00%	74.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315931790	T -> C	LOC_Os03g27770.1	upstream_gene_variant ; 4356.0bp to feature; MODIFIER	silent_mutation	Average:64.843; most accessible tissue: Callus, score: 88.732	N	N	N	N
vg0315931790	T -> C	LOC_Os03g27780.1	upstream_gene_variant ; 734.0bp to feature; MODIFIER	silent_mutation	Average:64.843; most accessible tissue: Callus, score: 88.732	N	N	N	N
vg0315931790	T -> C	LOC_Os03g27780.2	upstream_gene_variant ; 734.0bp to feature; MODIFIER	silent_mutation	Average:64.843; most accessible tissue: Callus, score: 88.732	N	N	N	N
vg0315931790	T -> C	LOC_Os03g27770-LOC_Os03g27780	intergenic_region ; MODIFIER	silent_mutation	Average:64.843; most accessible tissue: Callus, score: 88.732	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315931790	NA	3.10E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315931790	NA	8.97E-09	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315931790	NA	5.41E-10	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315931790	NA	1.20E-07	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315931790	3.69E-06	3.32E-06	mr1198_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315931790	NA	1.11E-06	mr1552_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251