\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315931790:

Variant ID: vg0315931790 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15931790
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTTTCTACACGAAAACGATTCCCGAATTGCTAAACGACGCGTCTTAAATTTTACTTCCTCCATTCTACGATGTAAGACTTTCTAGCATTGCCCACATT[T/C]
ATTTAGATGTTAATGAATCTAGACGTATGTATGTGTTTAGATTCATTAACATCTATATATATGTGAGCAATGCTAGAAAATCTTACATTGTGAAACGGTG

Reverse complement sequence

CACCGTTTCACAATGTAAGATTTTCTAGCATTGCTCACATATATATAGATGTTAATGAATCTAAACACATACATACGTCTAGATTCATTAACATCTAAAT[A/G]
AATGTGGGCAATGCTAGAAAGTCTTACATCGTAGAATGGAGGAAGTAAAATTTAAGACGCGTCGTTTAGCAATTCGGGAATCGTTTTCGTGTAGAAAAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 34.20% 0.08% 0.00% NA
All Indica  2759 85.20% 14.80% 0.00% 0.00% NA
All Japonica  1512 28.30% 71.50% 0.20% 0.00% NA
Aus  269 88.50% 11.20% 0.37% 0.00% NA
Indica I  595 88.60% 11.40% 0.00% 0.00% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 79.20% 20.80% 0.00% 0.00% NA
Indica Intermediate  786 88.70% 11.30% 0.00% 0.00% NA
Temperate Japonica  767 5.60% 94.40% 0.00% 0.00% NA
Tropical Japonica  504 63.30% 36.30% 0.40% 0.00% NA
Japonica Intermediate  241 27.40% 72.20% 0.41% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315931790 T -> C LOC_Os03g27770.1 upstream_gene_variant ; 4356.0bp to feature; MODIFIER silent_mutation Average:64.843; most accessible tissue: Callus, score: 88.732 N N N N
vg0315931790 T -> C LOC_Os03g27780.1 upstream_gene_variant ; 734.0bp to feature; MODIFIER silent_mutation Average:64.843; most accessible tissue: Callus, score: 88.732 N N N N
vg0315931790 T -> C LOC_Os03g27780.2 upstream_gene_variant ; 734.0bp to feature; MODIFIER silent_mutation Average:64.843; most accessible tissue: Callus, score: 88.732 N N N N
vg0315931790 T -> C LOC_Os03g27770-LOC_Os03g27780 intergenic_region ; MODIFIER silent_mutation Average:64.843; most accessible tissue: Callus, score: 88.732 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315931790 NA 3.10E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315931790 NA 8.97E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315931790 NA 5.41E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315931790 NA 1.20E-07 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315931790 3.69E-06 3.32E-06 mr1198_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315931790 NA 1.11E-06 mr1552_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251