Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0315803692:

Variant ID: vg0315803692 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 15803692
Reference Allele: T	Alternative Allele: TG,G
Primary Allele: TG	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, G: 0.38, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:

GGAACATGCTAGGCAGGGTTAGTTCCGGCACCGCCGCGTTTGCCAGGCGCCAAAGTTCAGCATCGGCGGCCATAACCTTTGCCACTTCGACCCAGGGCCT[T/TG,G]
TGTTGTTGATTGAAAATCCTATCATTCCTCTCCGTAATCCGCCGTTTGATTGGCATCCATGTTTAGGCTGCTGCTTATAACCTCCCAGCTTTTTGCCAAA

Reverse complement sequence

TTTGGCAAAAAGCTGGGAGGTTATAAGCAGCAGCCTAAACATGGATGCCAATCAAACGGCGGATTACGGAGAGGAATGATAGGATTTTCAATCAACAACA[A/CA,C]
AGGCCCTGGGTCGAAGTGGCAAAGGTTATGGCCGCCGATGCTGAACTTTGGCGCCTGGCAAACGCGGCGGTGCCGGAACTAACCCTGCCTAGCATGTTCC

Allele Frequencies:

Populations	Population Size	Frequency of TG(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.40%	29.40%	0.17%	0.30%	G: 3.72%
All Indica	2759	89.20%	9.20%	0.18%	0.47%	G: 0.94%
All Japonica	1512	33.50%	66.40%	0.00%	0.00%	G: 0.13%
Aus	269	36.40%	14.50%	0.00%	0.00%	G: 49.07%
Indica I	595	98.70%	0.30%	0.50%	0.50%	NA
Indica II	465	88.20%	10.80%	0.00%	0.86%	G: 0.22%
Indica III	913	80.60%	17.20%	0.00%	0.44%	G: 1.75%
Indica Intermediate	786	92.50%	5.90%	0.25%	0.25%	G: 1.15%
Temperate Japonica	767	4.70%	95.30%	0.00%	0.00%	NA
Tropical Japonica	504	79.00%	20.60%	0.00%	0.00%	G: 0.40%
Japonica Intermediate	241	29.90%	70.10%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	71.90%	1.04%	0.00%	G: 6.25%
Intermediate	90	62.20%	23.30%	2.22%	1.11%	G: 11.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315803692	T -> DEL	N	N	silent_mutation	Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417	N	N	N	N
vg0315803692	T -> G	LOC_Os03g27550.1	upstream_gene_variant ; 1781.0bp to feature; MODIFIER	silent_mutation	Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417	N	N	N	N
vg0315803692	T -> G	LOC_Os03g27540.1	downstream_gene_variant ; 2729.0bp to feature; MODIFIER	silent_mutation	Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417	N	N	N	N
vg0315803692	T -> G	LOC_Os03g27560.1	downstream_gene_variant ; 2574.0bp to feature; MODIFIER	silent_mutation	Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417	N	N	N	N
vg0315803692	T -> G	LOC_Os03g27550-LOC_Os03g27560	intergenic_region ; MODIFIER	silent_mutation	Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417	N	N	N	N
vg0315803692	T -> TG	LOC_Os03g27550.1	upstream_gene_variant ; 1782.0bp to feature; MODIFIER	silent_mutation	Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417	N	N	N	N
vg0315803692	T -> TG	LOC_Os03g27540.1	downstream_gene_variant ; 2730.0bp to feature; MODIFIER	silent_mutation	Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417	N	N	N	N
vg0315803692	T -> TG	LOC_Os03g27560.1	downstream_gene_variant ; 2573.0bp to feature; MODIFIER	silent_mutation	Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417	N	N	N	N
vg0315803692	T -> TG	LOC_Os03g27550-LOC_Os03g27560	intergenic_region ; MODIFIER	silent_mutation	Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315803692	2.30E-06	NA	mr1063_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315803692	NA	6.35E-06	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315803692	NA	1.35E-07	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315803692	6.36E-07	NA	mr1922_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251