\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315803692:

Variant ID: vg0315803692 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 15803692
Reference Allele: TAlternative Allele: TG,G
Primary Allele: TGSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, G: 0.38, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


GGAACATGCTAGGCAGGGTTAGTTCCGGCACCGCCGCGTTTGCCAGGCGCCAAAGTTCAGCATCGGCGGCCATAACCTTTGCCACTTCGACCCAGGGCCT[T/TG,G]
TGTTGTTGATTGAAAATCCTATCATTCCTCTCCGTAATCCGCCGTTTGATTGGCATCCATGTTTAGGCTGCTGCTTATAACCTCCCAGCTTTTTGCCAAA

Reverse complement sequence

TTTGGCAAAAAGCTGGGAGGTTATAAGCAGCAGCCTAAACATGGATGCCAATCAAACGGCGGATTACGGAGAGGAATGATAGGATTTTCAATCAACAACA[A/CA,C]
AGGCCCTGGGTCGAAGTGGCAAAGGTTATGGCCGCCGATGCTGAACTTTGGCGCCTGGCAAACGCGGCGGTGCCGGAACTAACCCTGCCTAGCATGTTCC

Allele Frequencies:

Populations Population SizeFrequency of TG(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 29.40% 0.17% 0.30% G: 3.72%
All Indica  2759 89.20% 9.20% 0.18% 0.47% G: 0.94%
All Japonica  1512 33.50% 66.40% 0.00% 0.00% G: 0.13%
Aus  269 36.40% 14.50% 0.00% 0.00% G: 49.07%
Indica I  595 98.70% 0.30% 0.50% 0.50% NA
Indica II  465 88.20% 10.80% 0.00% 0.86% G: 0.22%
Indica III  913 80.60% 17.20% 0.00% 0.44% G: 1.75%
Indica Intermediate  786 92.50% 5.90% 0.25% 0.25% G: 1.15%
Temperate Japonica  767 4.70% 95.30% 0.00% 0.00% NA
Tropical Japonica  504 79.00% 20.60% 0.00% 0.00% G: 0.40%
Japonica Intermediate  241 29.90% 70.10% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 71.90% 1.04% 0.00% G: 6.25%
Intermediate  90 62.20% 23.30% 2.22% 1.11% G: 11.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315803692 T -> DEL N N silent_mutation Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0315803692 T -> G LOC_Os03g27550.1 upstream_gene_variant ; 1781.0bp to feature; MODIFIER silent_mutation Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0315803692 T -> G LOC_Os03g27540.1 downstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0315803692 T -> G LOC_Os03g27560.1 downstream_gene_variant ; 2574.0bp to feature; MODIFIER silent_mutation Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0315803692 T -> G LOC_Os03g27550-LOC_Os03g27560 intergenic_region ; MODIFIER silent_mutation Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0315803692 T -> TG LOC_Os03g27550.1 upstream_gene_variant ; 1782.0bp to feature; MODIFIER silent_mutation Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0315803692 T -> TG LOC_Os03g27540.1 downstream_gene_variant ; 2730.0bp to feature; MODIFIER silent_mutation Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0315803692 T -> TG LOC_Os03g27560.1 downstream_gene_variant ; 2573.0bp to feature; MODIFIER silent_mutation Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0315803692 T -> TG LOC_Os03g27550-LOC_Os03g27560 intergenic_region ; MODIFIER silent_mutation Average:63.481; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315803692 2.30E-06 NA mr1063_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315803692 NA 6.35E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315803692 NA 1.35E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315803692 6.36E-07 NA mr1922_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251