Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0315684189:

Variant ID: vg0315684189 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15684189
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATCCTAATGGGCGATCGACCCCCCGGAGACGGGGGGTAGCGATCGATCCCCTCCCCCCTCCCTCCCTCCACCCCTCCACTGGTTTCCTTTTTTGGCACC[G/A]
CATTACTTTCCTATTTTAGAAAATTTATACACTTAAAGTTTATACACCTCAAGTTTACACATCTAAAGTTTAGAGACCAAAAGTTTATAAGTCAAAAGTT

Reverse complement sequence

AACTTTTGACTTATAAACTTTTGGTCTCTAAACTTTAGATGTGTAAACTTGAGGTGTATAAACTTTAAGTGTATAAATTTTCTAAAATAGGAAAGTAATG[C/T]
GGTGCCAAAAAAGGAAACCAGTGGAGGGGTGGAGGGAGGGAGGGGGGAGGGGATCGATCGCTACCCCCCGTCTCCGGGGGGTCGATCGCCCATTAGGATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	3.70%	0.66%	0.00%	NA
All Indica	2759	98.00%	1.50%	0.47%	0.00%	NA
All Japonica	1512	89.90%	8.90%	1.19%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	97.40%	2.30%	0.33%	0.00%	NA
Indica Intermediate	786	96.30%	2.40%	1.27%	0.00%	NA
Temperate Japonica	767	95.30%	3.70%	1.04%	0.00%	NA
Tropical Japonica	504	95.00%	5.00%	0.00%	0.00%	NA
Japonica Intermediate	241	61.80%	34.00%	4.15%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315684189	G -> A	LOC_Os03g27380.1	upstream_gene_variant ; 1275.0bp to feature; MODIFIER	silent_mutation	Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0315684189	G -> A	LOC_Os03g27370.1	downstream_gene_variant ; 4975.0bp to feature; MODIFIER	silent_mutation	Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0315684189	G -> A	LOC_Os03g27390.1	downstream_gene_variant ; 1353.0bp to feature; MODIFIER	silent_mutation	Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0315684189	G -> A	LOC_Os03g27390.2	downstream_gene_variant ; 1353.0bp to feature; MODIFIER	silent_mutation	Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0315684189	G -> A	LOC_Os03g27380-LOC_Os03g27390	intergenic_region ; MODIFIER	silent_mutation	Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315684189	NA	6.90E-09	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	9.47E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	9.04E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	6.56E-07	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	3.85E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	1.84E-08	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	8.04E-06	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	5.18E-10	1.88E-13	mr1113_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	7.84E-08	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	3.29E-07	2.04E-11	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	1.40E-08	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	3.25E-06	4.33E-10	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	8.27E-07	5.98E-10	mr1120_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	4.95E-09	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	1.85E-08	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	4.11E-08	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	1.06E-08	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	8.24E-07	1.25E-11	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189	NA	6.81E-07	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251