\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315684189:

Variant ID: vg0315684189 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15684189
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCCTAATGGGCGATCGACCCCCCGGAGACGGGGGGTAGCGATCGATCCCCTCCCCCCTCCCTCCCTCCACCCCTCCACTGGTTTCCTTTTTTGGCACC[G/A]
CATTACTTTCCTATTTTAGAAAATTTATACACTTAAAGTTTATACACCTCAAGTTTACACATCTAAAGTTTAGAGACCAAAAGTTTATAAGTCAAAAGTT

Reverse complement sequence

AACTTTTGACTTATAAACTTTTGGTCTCTAAACTTTAGATGTGTAAACTTGAGGTGTATAAACTTTAAGTGTATAAATTTTCTAAAATAGGAAAGTAATG[C/T]
GGTGCCAAAAAAGGAAACCAGTGGAGGGGTGGAGGGAGGGAGGGGGGAGGGGATCGATCGCTACCCCCCGTCTCCGGGGGGTCGATCGCCCATTAGGATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 3.70% 0.66% 0.00% NA
All Indica  2759 98.00% 1.50% 0.47% 0.00% NA
All Japonica  1512 89.90% 8.90% 1.19% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.40% 2.30% 0.33% 0.00% NA
Indica Intermediate  786 96.30% 2.40% 1.27% 0.00% NA
Temperate Japonica  767 95.30% 3.70% 1.04% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 61.80% 34.00% 4.15% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315684189 G -> A LOC_Os03g27380.1 upstream_gene_variant ; 1275.0bp to feature; MODIFIER silent_mutation Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0315684189 G -> A LOC_Os03g27370.1 downstream_gene_variant ; 4975.0bp to feature; MODIFIER silent_mutation Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0315684189 G -> A LOC_Os03g27390.1 downstream_gene_variant ; 1353.0bp to feature; MODIFIER silent_mutation Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0315684189 G -> A LOC_Os03g27390.2 downstream_gene_variant ; 1353.0bp to feature; MODIFIER silent_mutation Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0315684189 G -> A LOC_Os03g27380-LOC_Os03g27390 intergenic_region ; MODIFIER silent_mutation Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315684189 NA 6.90E-09 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 9.47E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 9.04E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 6.56E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 3.85E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 1.84E-08 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 8.04E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 5.18E-10 1.88E-13 mr1113_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 7.84E-08 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 3.29E-07 2.04E-11 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 1.40E-08 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 3.25E-06 4.33E-10 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 8.27E-07 5.98E-10 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 4.95E-09 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 1.85E-08 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 4.11E-08 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 1.06E-08 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 8.24E-07 1.25E-11 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315684189 NA 6.81E-07 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251