\
| Variant ID: vg0315684189 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15684189 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATCCTAATGGGCGATCGACCCCCCGGAGACGGGGGGTAGCGATCGATCCCCTCCCCCCTCCCTCCCTCCACCCCTCCACTGGTTTCCTTTTTTGGCACC[G/A]
CATTACTTTCCTATTTTAGAAAATTTATACACTTAAAGTTTATACACCTCAAGTTTACACATCTAAAGTTTAGAGACCAAAAGTTTATAAGTCAAAAGTT
AACTTTTGACTTATAAACTTTTGGTCTCTAAACTTTAGATGTGTAAACTTGAGGTGTATAAACTTTAAGTGTATAAATTTTCTAAAATAGGAAAGTAATG[C/T]
GGTGCCAAAAAAGGAAACCAGTGGAGGGGTGGAGGGAGGGAGGGGGGAGGGGATCGATCGCTACCCCCCGTCTCCGGGGGGTCGATCGCCCATTAGGATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.60% | 3.70% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 1.50% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 89.90% | 8.90% | 1.19% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.40% | 2.30% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 2.40% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 95.30% | 3.70% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.80% | 34.00% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315684189 | G -> A | LOC_Os03g27380.1 | upstream_gene_variant ; 1275.0bp to feature; MODIFIER | silent_mutation | Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0315684189 | G -> A | LOC_Os03g27370.1 | downstream_gene_variant ; 4975.0bp to feature; MODIFIER | silent_mutation | Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0315684189 | G -> A | LOC_Os03g27390.1 | downstream_gene_variant ; 1353.0bp to feature; MODIFIER | silent_mutation | Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0315684189 | G -> A | LOC_Os03g27390.2 | downstream_gene_variant ; 1353.0bp to feature; MODIFIER | silent_mutation | Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0315684189 | G -> A | LOC_Os03g27380-LOC_Os03g27390 | intergenic_region ; MODIFIER | silent_mutation | Average:65.167; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315684189 | NA | 6.90E-09 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 9.47E-06 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 9.04E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 6.56E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 3.85E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 1.84E-08 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 8.04E-06 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | 5.18E-10 | 1.88E-13 | mr1113_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 7.84E-08 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | 3.29E-07 | 2.04E-11 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 1.40E-08 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | 3.25E-06 | 4.33E-10 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | 8.27E-07 | 5.98E-10 | mr1120_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 4.95E-09 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 1.85E-08 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 4.11E-08 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 1.06E-08 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | 8.24E-07 | 1.25E-11 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315684189 | NA | 6.81E-07 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |