\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315495240:

Variant ID: vg0315495240 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 15495240
Reference Allele: TAlternative Allele: TA,A,TAA,TTA,TTTA,TAAA
Primary Allele: TASecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTGCTAGTTTCACTAGTACTATATATATTTAACCATATGATATTTTTACATGACGTTTCGTAGAACTTTCAAAACTTTAAATGTTGATGTTTTTTTTT[T/TA,A,TAA,TTA,TTTA,TAAA]
AAAAAAAACAGACTGGTTGGGAGGAAGGAGTACAAGCTAGGCTTGTTGTGTCATTTAAAAAGAAACTAAAACCACAATTTCTTATAATATAATAAATGAG

Reverse complement sequence

CTCATTTATTATATTATAAGAAATTGTGGTTTTAGTTTCTTTTTAAATGACACAACAAGCCTAGCTTGTACTCCTTCCTCCCAACCAGTCTGTTTTTTTT[A/TA,T,TTA,TAA,TAAA,TTTA]
AAAAAAAAACATCAACATTTAAAGTTTTGAAAGTTCTACGAAACGTCATGTAAAAATATCATATGGTTAAATATATATAGTACTAGTGAAACTAGCAATG

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.80% 26.40% 3.77% 0.00% T: 23.36%; TTA: 1.40%; TAA: 0.74%; TTTA: 0.53%; TAAA: 0.04%
All Indica  2759 62.70% 22.80% 5.11% 0.00% T: 6.60%; TTA: 1.78%; TTTA: 0.54%; TAA: 0.47%; TAAA: 0.04%
All Japonica  1512 15.30% 24.30% 1.12% 0.00% T: 58.33%; TTTA: 0.53%; TAA: 0.33%; TAAA: 0.07%
Aus  269 19.30% 56.90% 7.06% 0.00% T: 6.32%; TTA: 5.95%; TAA: 4.46%
Indica I  595 33.60% 50.80% 10.08% 0.00% T: 5.21%; TAA: 0.34%
Indica II  465 79.80% 11.00% 3.23% 0.00% T: 4.73%; TTA: 0.86%; TAA: 0.43%
Indica III  913 66.00% 17.50% 1.53% 0.00% T: 10.62%; TTA: 3.72%; TAA: 0.33%; TAAA: 0.11%; TTTA: 0.11%
Indica Intermediate  786 70.70% 14.60% 6.62% 0.00% T: 4.07%; TTTA: 1.78%; TTA: 1.40%; TAA: 0.76%
Temperate Japonica  767 1.30% 18.90% 0.26% 0.00% T: 79.53%
Tropical Japonica  504 41.50% 23.00% 2.98% 0.00% T: 30.16%; TTTA: 1.59%; TAA: 0.60%; TAAA: 0.20%
Japonica Intermediate  241 5.00% 44.40% 0.00% 0.00% T: 49.79%; TAA: 0.83%
VI/Aromatic  96 9.40% 82.30% 0.00% 0.00% T: 7.29%; TAA: 1.04%
Intermediate  90 51.10% 22.20% 1.11% 0.00% T: 17.78%; TAA: 4.44%; TTTA: 2.22%; TTA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315495240 T -> TTA LOC_Os03g27060.1 upstream_gene_variant ; 3647.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TTA LOC_Os03g27070.1 downstream_gene_variant ; 1278.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TTA LOC_Os03g27070-LOC_Os03g27080 intergenic_region ; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TA LOC_Os03g27060.1 upstream_gene_variant ; 3647.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TA LOC_Os03g27070.1 downstream_gene_variant ; 1278.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TA LOC_Os03g27070-LOC_Os03g27080 intergenic_region ; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TAA LOC_Os03g27060.1 upstream_gene_variant ; 3647.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TAA LOC_Os03g27070.1 downstream_gene_variant ; 1278.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TAA LOC_Os03g27070-LOC_Os03g27080 intergenic_region ; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TTTA LOC_Os03g27060.1 upstream_gene_variant ; 3647.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TTTA LOC_Os03g27070.1 downstream_gene_variant ; 1278.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TTTA LOC_Os03g27070-LOC_Os03g27080 intergenic_region ; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TAAA LOC_Os03g27060.1 upstream_gene_variant ; 3647.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TAAA LOC_Os03g27070.1 downstream_gene_variant ; 1278.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> TAAA LOC_Os03g27070-LOC_Os03g27080 intergenic_region ; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> A LOC_Os03g27060.1 upstream_gene_variant ; 3646.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> A LOC_Os03g27070.1 downstream_gene_variant ; 1277.0bp to feature; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N
vg0315495240 T -> A LOC_Os03g27070-LOC_Os03g27080 intergenic_region ; MODIFIER silent_mutation Average:77.886; most accessible tissue: Callus, score: 92.356 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315495240 T A -0.02 0.0 0.01 -0.01 0.0 0.0
vg0315495240 T TA 0.04 0.12 0.23 0.03 0.1 0.01
vg0315495240 T TAA -0.12 0.03 0.08 -0.07 0.03 -0.09
vg0315495240 T TAAA -0.07 -0.18 -0.27 -0.11 -0.02 -0.11
vg0315495240 T TTA -0.1 0.05 0.09 -0.07 0.04 -0.08
vg0315495240 T TTTA -0.05 -0.16 -0.26 -0.1 -0.01 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315495240 NA 1.00E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315495240 NA 4.26E-12 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315495240 NA 5.39E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315495240 NA 8.39E-12 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315495240 3.88E-06 7.58E-13 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315495240 NA 4.29E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315495240 NA 2.54E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315495240 1.46E-07 1.33E-11 mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315495240 NA 4.99E-11 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315495240 NA 2.54E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315495240 NA 6.73E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251