Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0315369570:

Variant ID: vg0315369570 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15369570
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, G: 0.06, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TATGCACAAACATGATCAACATTTCCGATGGATAGATAATTGCTCAAAACACGGCGTACGCACGGTGATGGATCGATGAAGCGACCGAGAGTCGACAGAC[T/G]
ATCGATGGGGCGTGTACGTCTGTCTGTCCAACTGAGAGAGGCCGACGCCGGCCTCAATCGAGACAGATCACGCACATATCACTGACGACGACGACGATGA

Reverse complement sequence

TCATCGTCGTCGTCGTCAGTGATATGTGCGTGATCTGTCTCGATTGAGGCCGGCGTCGGCCTCTCTCAGTTGGACAGACAGACGTACACGCCCCATCGAT[A/C]
GTCTGTCGACTCTCGGTCGCTTCATCGATCCATCACCGTGCGTACGCCGTGTTTTGAGCAATTATCTATCCATCGGAAATGTTGATCATGTTTGTGCATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 9.50% 0.38% 0.00% NA
All Indica  2759 95.00% 4.80% 0.14% 0.00% NA
All Japonica  1512 83.90% 15.20% 0.86% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 90.10% 9.60% 0.22% 0.00% NA
Indica Intermediate  786 97.70% 2.00% 0.25% 0.00% NA
Temperate Japonica  767 88.80% 9.60% 1.56% 0.00% NA
Tropical Japonica  504 89.70% 10.30% 0.00% 0.00% NA
Japonica Intermediate  241 56.40% 43.20% 0.41% 0.00% NA
VI/Aromatic  96 18.80% 80.20% 1.04% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315369570 T -> G LOC_Os03g26900-LOC_Os03g26910 intergenic_region ; MODIFIER silent_mutation Average:93.072; most accessible tissue: Zhenshan97 young leaf, score: 96.097 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315369570 T G -0.14 -0.16 -0.16 -0.06 -0.12 -0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315369570 5.44E-07 NA mr1379 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315369570 NA 2.88E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315369570 NA 8.04E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315369570 NA 6.53E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315369570 NA 5.84E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251