Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315310293:

Variant ID: vg0315310293 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 15310293
Reference Allele: AGCGAlternative Allele: A,GGCG
Primary Allele: ASecondary Allele: AGCG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGCAGATCCAACGACTGTGGGCTTTTCGGCAGCCAGCGAGGCCGATGGCACTTGTCTCCAGCGTTGGTGCAAGTAGTGTGCATCTGGCTCTAGTTAGC[AGCG/A,GGCG]
ATAGCGTGAGGAGGATACAGGAGTTGAAGGAAAGAAGGAAGGGGTTTTAGGGTTTGGTTGCCTAGCACGAATCTTAAAGCCATTGGACGATCTAGAATTT

Reverse complement sequence

AAATTCTAGATCGTCCAATGGCTTTAAGATTCGTGCTAGGCAACCAAACCCTAAAACCCCTTCCTTCTTTCCTTCAACTCCTGTATCCTCCTCACGCTAT[CGCT/T,CGCC]
GCTAACTAGAGCCAGATGCACACTACTTGCACCAACGCTGGAGACAAGTGCCATCGGCCTCGCTGGCTGCCGAAAAGCCCACAGTCGTTGGATCTGCCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AGCG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 23.40% 1.42% 5.14% GGCG: 19.34%
All Indica  2759 74.90% 2.40% 2.25% 7.72% GGCG: 12.76%
All Japonica  1512 18.50% 61.80% 0.20% 1.85% GGCG: 17.66%
Aus  269 0.40% 0.40% 0.00% 0.37% GGCG: 98.88%
Indica I  595 85.50% 1.50% 2.69% 3.53% GGCG: 6.72%
Indica II  465 82.60% 1.30% 2.37% 7.53% GGCG: 6.24%
Indica III  913 64.70% 3.90% 2.19% 9.97% GGCG: 19.17%
Indica Intermediate  786 74.00% 1.90% 1.91% 8.40% GGCG: 13.74%
Temperate Japonica  767 3.40% 92.70% 0.13% 0.00% GGCG: 3.78%
Tropical Japonica  504 40.90% 24.20% 0.00% 4.17% GGCG: 30.75%
Japonica Intermediate  241 19.90% 41.90% 0.83% 2.90% GGCG: 34.44%
VI/Aromatic  96 8.30% 83.30% 1.04% 0.00% GGCG: 7.29%
Intermediate  90 44.40% 28.90% 1.11% 1.11% GGCG: 24.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315310293 AGCG -> A LOC_Os03g26810.1 downstream_gene_variant ; 4846.0bp to feature; MODIFIER silent_mutation Average:72.687; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N
vg0315310293 AGCG -> A LOC_Os03g26820.1 downstream_gene_variant ; 479.0bp to feature; MODIFIER silent_mutation Average:72.687; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N
vg0315310293 AGCG -> A LOC_Os03g26830.1 downstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:72.687; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N
vg0315310293 AGCG -> A LOC_Os03g26820-LOC_Os03g26830 intergenic_region ; MODIFIER silent_mutation Average:72.687; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N
vg0315310293 AGCG -> DEL N N silent_mutation Average:72.687; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N
vg0315310293 AGCG -> GGCG LOC_Os03g26810.1 downstream_gene_variant ; 4845.0bp to feature; MODIFIER silent_mutation Average:72.687; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N
vg0315310293 AGCG -> GGCG LOC_Os03g26820.1 downstream_gene_variant ; 478.0bp to feature; MODIFIER silent_mutation Average:72.687; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N
vg0315310293 AGCG -> GGCG LOC_Os03g26830.1 downstream_gene_variant ; 1438.0bp to feature; MODIFIER silent_mutation Average:72.687; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N
vg0315310293 AGCG -> GGCG LOC_Os03g26820-LOC_Os03g26830 intergenic_region ; MODIFIER silent_mutation Average:72.687; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315310293 AGCG A -0.07 -0.19 -0.18 -0.02 -0.07 -0.05
vg0315310293 AGCG GGCG -0.02 0.01 -0.01 -0.05 -0.09 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315310293 NA 8.75E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 6.48E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.29E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.18E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.02E-09 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.99E-07 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.63E-08 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 4.42E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 4.37E-11 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 9.54E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 4.19E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.41E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.81E-08 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 5.09E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.90E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.79E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 6.04E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 3.90E-08 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.24E-06 mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 3.47E-08 mr1283 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 9.93E-08 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 3.72E-07 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.80E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 4.48E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.49E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.15E-07 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 5.56E-09 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.20E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 4.03E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 7.37E-08 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.73E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 5.03E-07 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.45E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 4.32E-08 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.42E-07 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 6.06E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.06E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 3.13E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.12E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 3.98E-06 mr1412 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 3.62E-06 4.52E-10 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.95E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.17E-09 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 3.77E-08 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 9.98E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 5.14E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.12E-08 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 4.83E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 8.36E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 9.57E-06 mr1469 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.11E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.11E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 7.30E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 6.03E-10 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 3.79E-08 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.92E-13 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.97E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.57E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 1.24E-06 1.24E-06 mr1562 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.35E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 1.43E-06 1.43E-06 mr1605 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 6.39E-09 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.82E-09 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.73E-07 mr1635 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 5.08E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 7.71E-09 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 5.66E-08 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 8.98E-13 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 5.54E-08 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 9.93E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 3.51E-10 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 3.26E-08 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 9.53E-07 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.76E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.15E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 8.68E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 4.95E-12 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 3.11E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.79E-06 mr1963 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.15E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 7.15E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.08E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.71E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 2.61E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315310293 NA 1.28E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251