\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315250257:

Variant ID: vg0315250257 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15250257
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGTATCATTTGTACTCGAGCCGATGTCATCTTTGCATCGATCGGCTGTGCGAGGCAATAATATAGGAACTAAACCTATTCGATCGATTGTAGTTATTAA[C/T]
AATATATAATCTTTATGTCGATATATACTTAAATCAAGTGATTGGGATAGATCGGTCGCTATGCCGAGACAATATAAATCACTTAGATTGAAATATAGAT

Reverse complement sequence

ATCTATATTTCAATCTAAGTGATTTATATTGTCTCGGCATAGCGACCGATCTATCCCAATCACTTGATTTAAGTATATATCGACATAAAGATTATATATT[G/A]
TTAATAACTACAATCGATCGAATAGGTTTAGTTCCTATATTATTGCCTCGCACAGCCGATCGATGCAAAGATGACATCGGCTCGAGTACAAATGATACGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 7.90% 11.30% 26.32% NA
All Indica  2759 39.60% 7.40% 13.77% 39.25% NA
All Japonica  1512 83.20% 5.60% 5.16% 6.02% NA
Aus  269 57.20% 0.40% 21.56% 20.82% NA
Indica I  595 43.70% 6.40% 16.97% 32.94% NA
Indica II  465 40.90% 2.40% 15.91% 40.86% NA
Indica III  913 36.10% 11.00% 9.64% 43.26% NA
Indica Intermediate  786 39.80% 6.90% 14.89% 38.42% NA
Temperate Japonica  767 96.00% 1.80% 0.39% 1.83% NA
Tropical Japonica  504 69.80% 8.10% 12.90% 9.13% NA
Japonica Intermediate  241 70.50% 12.40% 4.15% 12.86% NA
VI/Aromatic  96 14.60% 77.10% 6.25% 2.08% NA
Intermediate  90 63.30% 10.00% 13.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315250257 C -> T LOC_Os03g26704.1 upstream_gene_variant ; 325.0bp to feature; MODIFIER silent_mutation Average:11.036; most accessible tissue: Callus, score: 33.111 N N N N
vg0315250257 C -> T LOC_Os03g26730.1 upstream_gene_variant ; 4863.0bp to feature; MODIFIER silent_mutation Average:11.036; most accessible tissue: Callus, score: 33.111 N N N N
vg0315250257 C -> T LOC_Os03g26720.1 downstream_gene_variant ; 1227.0bp to feature; MODIFIER silent_mutation Average:11.036; most accessible tissue: Callus, score: 33.111 N N N N
vg0315250257 C -> T LOC_Os03g26704-LOC_Os03g26720 intergenic_region ; MODIFIER silent_mutation Average:11.036; most accessible tissue: Callus, score: 33.111 N N N N
vg0315250257 C -> DEL N N silent_mutation Average:11.036; most accessible tissue: Callus, score: 33.111 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315250257 NA 8.79E-10 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 4.54E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 5.14E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 5.00E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 1.62E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 8.61E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 1.14E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 1.23E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 7.37E-07 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 7.04E-08 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 3.60E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 8.59E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 9.25E-11 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 6.32E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 1.95E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 9.07E-06 NA mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 1.83E-07 NA mr1333_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 2.38E-10 mr1346_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 3.49E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 1.32E-07 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 1.19E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 2.50E-08 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 1.71E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 1.93E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 2.03E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257 NA 2.38E-07 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251