Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315250257:

Variant ID: vg0315250257 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15250257
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGTATCATTTGTACTCGAGCCGATGTCATCTTTGCATCGATCGGCTGTGCGAGGCAATAATATAGGAACTAAACCTATTCGATCGATTGTAGTTATTAA[C/T]
AATATATAATCTTTATGTCGATATATACTTAAATCAAGTGATTGGGATAGATCGGTCGCTATGCCGAGACAATATAAATCACTTAGATTGAAATATAGAT

Reverse complement sequence

ATCTATATTTCAATCTAAGTGATTTATATTGTCTCGGCATAGCGACCGATCTATCCCAATCACTTGATTTAAGTATATATCGACATAAAGATTATATATT[G/A]
TTAATAACTACAATCGATCGAATAGGTTTAGTTCCTATATTATTGCCTCGCACAGCCGATCGATGCAAAGATGACATCGGCTCGAGTACAAATGATACGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.50%	7.90%	11.30%	26.32%	NA
All Indica	2759	39.60%	7.40%	13.77%	39.25%	NA
All Japonica	1512	83.20%	5.60%	5.16%	6.02%	NA
Aus	269	57.20%	0.40%	21.56%	20.82%	NA
Indica I	595	43.70%	6.40%	16.97%	32.94%	NA
Indica II	465	40.90%	2.40%	15.91%	40.86%	NA
Indica III	913	36.10%	11.00%	9.64%	43.26%	NA
Indica Intermediate	786	39.80%	6.90%	14.89%	38.42%	NA
Temperate Japonica	767	96.00%	1.80%	0.39%	1.83%	NA
Tropical Japonica	504	69.80%	8.10%	12.90%	9.13%	NA
Japonica Intermediate	241	70.50%	12.40%	4.15%	12.86%	NA
VI/Aromatic	96	14.60%	77.10%	6.25%	2.08%	NA
Intermediate	90	63.30%	10.00%	13.33%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315250257	C -> T	LOC_Os03g26704.1	upstream_gene_variant ; 325.0bp to feature; MODIFIER	silent_mutation	Average:11.036; most accessible tissue: Callus, score: 33.111	N	N	N	N
vg0315250257	C -> T	LOC_Os03g26730.1	upstream_gene_variant ; 4863.0bp to feature; MODIFIER	silent_mutation	Average:11.036; most accessible tissue: Callus, score: 33.111	N	N	N	N
vg0315250257	C -> T	LOC_Os03g26720.1	downstream_gene_variant ; 1227.0bp to feature; MODIFIER	silent_mutation	Average:11.036; most accessible tissue: Callus, score: 33.111	N	N	N	N
vg0315250257	C -> T	LOC_Os03g26704-LOC_Os03g26720	intergenic_region ; MODIFIER	silent_mutation	Average:11.036; most accessible tissue: Callus, score: 33.111	N	N	N	N
vg0315250257	C -> DEL	N	N	silent_mutation	Average:11.036; most accessible tissue: Callus, score: 33.111	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315250257	NA	8.79E-10	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	4.54E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	5.14E-06	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	5.00E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	1.62E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	8.61E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	1.14E-09	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	1.23E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	7.37E-07	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	7.04E-08	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	3.60E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	8.59E-19	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	9.25E-11	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	6.32E-08	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	1.95E-09	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	9.07E-06	NA	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	1.83E-07	NA	mr1333_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	2.38E-10	mr1346_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	3.49E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	1.32E-07	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	1.19E-06	mr1735_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	2.50E-08	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	1.71E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	1.93E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	2.03E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250257	NA	2.38E-07	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251