Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315178899:

Variant ID: vg0315178899 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15178899
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.37, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTTCTACCTCCAGCCACGAGTGAGTTTAGAGTGAGAATTGAGGGTTGCCGCCAACATTTGGTATCAGAGCCATGTCGGCTCTTGTGGGTGGTCAGTCC[T/C]
GCACGCCACACCGGCGTGGGCGACAGCATTCGCCGTCCCCTCCTCGCACTCGCGGCCAGCAGCTTGTCGTGCAGCGGGTAGTCAAGGAAGGGGGCTCTGT

Reverse complement sequence

ACAGAGCCCCCTTCCTTGACTACCCGCTGCACGACAAGCTGCTGGCCGCGAGTGCGAGGAGGGGACGGCGAATGCTGTCGCCCACGCCGGTGTGGCGTGC[A/G]
GGACTGACCACCCACAAGAGCCGACATGGCTCTGATACCAAATGTTGGCGGCAACCCTCAATTCTCACTCTAAACTCACTCGTGGCTGGAGGTAGAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.60%	17.70%	1.48%	55.23%	NA
All Indica	2759	6.30%	9.60%	2.36%	81.81%	NA
All Japonica	1512	61.40%	18.10%	0.13%	20.30%	NA
Aus	269	0.40%	98.90%	0.00%	0.74%	NA
Indica I	595	4.90%	4.00%	1.85%	89.24%	NA
Indica II	465	1.90%	9.00%	3.23%	85.81%	NA
Indica III	913	10.00%	11.70%	2.41%	75.90%	NA
Indica Intermediate	786	5.60%	11.60%	2.16%	80.66%	NA
Temperate Japonica	767	92.00%	4.40%	0.00%	3.52%	NA
Tropical Japonica	504	24.20%	31.30%	0.40%	44.05%	NA
Japonica Intermediate	241	41.90%	34.00%	0.00%	24.07%	NA
VI/Aromatic	96	84.40%	7.30%	0.00%	8.33%	NA
Intermediate	90	27.80%	28.90%	3.33%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315178899	T -> C	LOC_Os03g26570.1	missense_variant ; p.Cys10Arg; MODERATE	nonsynonymous_codon ; C10H	Average:49.676; most accessible tissue: Minghui63 young leaf, score: 78.054	unknown	unknown	TOLERATED	0.55
vg0315178899	T -> C	LOC_Os03g26570.1	missense_variant ; p.Cys10Arg; MODERATE	nonsynonymous_codon ; C10R	Average:49.676; most accessible tissue: Minghui63 young leaf, score: 78.054	unknown	unknown	TOLERATED	0.37
vg0315178899	T -> DEL	LOC_Os03g26570.1	N	frameshift_variant	Average:49.676; most accessible tissue: Minghui63 young leaf, score: 78.054	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315178899	NA	8.36E-09	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	1.16E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	3.75E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	1.38E-06	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	4.56E-06	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	8.13E-06	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	2.75E-07	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	9.68E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	4.26E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	4.80E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	4.68E-08	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	5.23E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	3.18E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	7.79E-08	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	2.52E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	3.87E-07	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	2.29E-08	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	1.85E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	3.35E-06	mr1444	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	5.88E-06	5.86E-06	mr1605	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	5.20E-07	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	6.25E-11	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	1.38E-06	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	9.98E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	1.62E-06	mr1963	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	8.48E-10	mr1070_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	6.64E-06	NA	mr1083_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	7.94E-07	8.25E-11	mr1085_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	1.18E-07	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	8.61E-06	3.62E-07	mr1224_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	2.91E-06	1.78E-08	mr1227_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	6.24E-07	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	7.71E-07	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	8.54E-06	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	1.20E-07	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	5.95E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	2.16E-06	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	NA	5.00E-06	mr1786_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315178899	5.48E-06	3.15E-07	mr1878_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251