\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315007040:

Variant ID: vg0315007040 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15007040
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.00, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATCATGATCATGTACTCATCAGGCAACACCACATCAGGTATGGATTTCAAATTTCTTATATGACTGGTGATTTAACTTAGGTACACTGCTGAAATGC[A/C]
TATGCATAAATAAACATGGGCTTGATTGAACATTGATTTTCTGTTTTGATAACCTCATAGCTCAGTATTTTCGAACTGCACTTCTGTTTTTCATTCTGGG

Reverse complement sequence

CCCAGAATGAAAAACAGAAGTGCAGTTCGAAAATACTGAGCTATGAGGTTATCAAAACAGAAAATCAATGTTCAATCAAGCCCATGTTTATTTATGCATA[T/G]
GCATTTCAGCAGTGTACCTAAGTTAAATCACCAGTCATATAAGAAATTTGAAATCCATACCTGATGTGGTGTTGCCTGATGAGTACATGATCATGATGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 41.10% 0.30% 0.61% NA
All Indica  2759 70.60% 28.60% 0.22% 0.58% NA
All Japonica  1512 43.30% 56.50% 0.07% 0.13% NA
Aus  269 1.10% 92.60% 2.60% 3.72% NA
Indica I  595 45.90% 53.60% 0.34% 0.17% NA
Indica II  465 50.80% 48.40% 0.22% 0.65% NA
Indica III  913 89.00% 10.10% 0.22% 0.66% NA
Indica Intermediate  786 79.50% 19.60% 0.13% 0.76% NA
Temperate Japonica  767 17.50% 82.40% 0.13% 0.00% NA
Tropical Japonica  504 64.30% 35.30% 0.00% 0.40% NA
Japonica Intermediate  241 81.70% 18.30% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 7.30% 0.00% 1.04% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315007040 A -> C LOC_Os03g26220.1 upstream_gene_variant ; 2477.0bp to feature; MODIFIER silent_mutation Average:56.228; most accessible tissue: Callus, score: 79.228 N N N N
vg0315007040 A -> C LOC_Os03g26250.1 upstream_gene_variant ; 4122.0bp to feature; MODIFIER silent_mutation Average:56.228; most accessible tissue: Callus, score: 79.228 N N N N
vg0315007040 A -> C LOC_Os03g26210.1 downstream_gene_variant ; 4835.0bp to feature; MODIFIER silent_mutation Average:56.228; most accessible tissue: Callus, score: 79.228 N N N N
vg0315007040 A -> C LOC_Os03g26240.1 downstream_gene_variant ; 1715.0bp to feature; MODIFIER silent_mutation Average:56.228; most accessible tissue: Callus, score: 79.228 N N N N
vg0315007040 A -> C LOC_Os03g26210.3 downstream_gene_variant ; 4835.0bp to feature; MODIFIER silent_mutation Average:56.228; most accessible tissue: Callus, score: 79.228 N N N N
vg0315007040 A -> C LOC_Os03g26210.2 downstream_gene_variant ; 4835.0bp to feature; MODIFIER silent_mutation Average:56.228; most accessible tissue: Callus, score: 79.228 N N N N
vg0315007040 A -> C LOC_Os03g26229.1 intron_variant ; MODIFIER silent_mutation Average:56.228; most accessible tissue: Callus, score: 79.228 N N N N
vg0315007040 A -> DEL N N silent_mutation Average:56.228; most accessible tissue: Callus, score: 79.228 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315007040 NA 1.32E-08 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 2.40E-06 2.40E-06 mr1053 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 9.17E-07 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 8.34E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 8.98E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 2.20E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 5.90E-06 5.90E-06 mr1169 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 5.07E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 2.14E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 1.25E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 1.18E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 1.48E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 3.21E-08 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 7.96E-07 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 5.67E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 1.31E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 7.59E-06 7.59E-06 mr1357 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 1.64E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 8.99E-06 8.99E-06 mr1366 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 1.00E-06 1.00E-06 mr1393 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 6.72E-06 6.72E-06 mr1412 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 9.73E-07 9.73E-07 mr1430 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 2.11E-09 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 5.45E-06 5.45E-06 mr1556 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 3.81E-07 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 4.37E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 1.03E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 9.82E-07 1.16E-07 mr1683 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 6.03E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 3.63E-06 2.63E-11 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 5.24E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 7.59E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 6.25E-08 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315007040 NA 4.09E-08 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251