Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315006440:

Variant ID: vg0315006440 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15006440
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCTTGACGTGGAAATGAAAACTGCACTCTGAAATGCACCTTTTGAATCCTAACCGAAAGAGTAAAGTGTTTGACTATAGGGGCATATATCTTGGAGAC[G/A]
TTCGCTCATGATATGAGGATCAGTAGCTCTTGATATAAATTGACTGTTGTTTCAAACGTGGTTTTTTATTTGATGCCTTAGATTTTCGTACATTTACCTG

Reverse complement sequence

CAGGTAAATGTACGAAAATCTAAGGCATCAAATAAAAAACCACGTTTGAAACAACAGTCAATTTATATCAAGAGCTACTGATCCTCATATCATGAGCGAA[C/T]
GTCTCCAAGATATATGCCCCTATAGTCAAACACTTTACTCTTTCGGTTAGGATTCAAAAGGTGCATTTCAGAGTGCAGTTTTCATTTCCACGTCAAGCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.20%	37.20%	2.56%	1.04%	NA
All Indica	2759	71.70%	27.80%	0.54%	0.00%	NA
All Japonica	1512	43.90%	46.30%	6.55%	3.24%	NA
Aus	269	4.80%	93.30%	1.86%	0.00%	NA
Indica I	595	47.10%	52.30%	0.67%	0.00%	NA
Indica II	465	52.70%	46.00%	1.29%	0.00%	NA
Indica III	913	89.70%	10.00%	0.33%	0.00%	NA
Indica Intermediate	786	80.70%	19.10%	0.25%	0.00%	NA
Temperate Japonica	767	18.00%	64.70%	11.86%	5.48%	NA
Tropical Japonica	504	65.30%	32.90%	0.60%	1.19%	NA
Japonica Intermediate	241	81.70%	15.80%	2.07%	0.41%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	57.80%	40.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315006440	G -> A	LOC_Os03g26220.1	upstream_gene_variant ; 1877.0bp to feature; MODIFIER	silent_mutation	Average:58.489; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006440	G -> A	LOC_Os03g26250.1	upstream_gene_variant ; 4722.0bp to feature; MODIFIER	silent_mutation	Average:58.489; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006440	G -> A	LOC_Os03g26210.1	downstream_gene_variant ; 4235.0bp to feature; MODIFIER	silent_mutation	Average:58.489; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006440	G -> A	LOC_Os03g26240.1	downstream_gene_variant ; 2315.0bp to feature; MODIFIER	silent_mutation	Average:58.489; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006440	G -> A	LOC_Os03g26210.3	downstream_gene_variant ; 4235.0bp to feature; MODIFIER	silent_mutation	Average:58.489; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006440	G -> A	LOC_Os03g26210.2	downstream_gene_variant ; 4235.0bp to feature; MODIFIER	silent_mutation	Average:58.489; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006440	G -> A	LOC_Os03g26229.1	intron_variant ; MODIFIER	silent_mutation	Average:58.489; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006440	G -> DEL	N	N	silent_mutation	Average:58.489; most accessible tissue: Callus, score: 82.42	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315006440	2.06E-06	2.06E-06	mr1030	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	6.87E-06	3.62E-09	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	2.30E-06	2.30E-06	mr1053	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	1.19E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	9.72E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	1.73E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	3.71E-06	mr1170	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	2.63E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	1.19E-07	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	1.27E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	9.58E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	6.29E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	7.55E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	3.70E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	4.37E-08	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	6.03E-07	mr1289	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	9.61E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	1.65E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	1.29E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	4.12E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	2.38E-06	2.38E-06	mr1412	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	5.94E-06	5.94E-06	mr1430	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	3.70E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	5.44E-09	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	9.23E-07	9.23E-07	mr1556	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	2.36E-07	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	8.10E-06	8.10E-06	mr1634	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	1.68E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	1.37E-06	2.16E-07	mr1683	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	2.23E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	5.15E-10	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	8.94E-07	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	1.55E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	8.55E-06	mr1809	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	6.85E-06	6.85E-06	mr1820	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	1.24E-07	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006440	NA	4.00E-06	mr1906	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251