\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315003502:

Variant ID: vg0315003502 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15003502
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAAACATCGAAGCACAGTACTTCCTATTTTTTGAGAAAAAAATAAATTTGAGGGTGAAAGATGTGAACTGTACTAGATCCAGAAGAAATTCACATAGT[A/G]
CGCATAATTTGTGAAACCAAGCTGCTACATTGGAAGCTTGGAGATAAACAATATATGCAACACGGTTATATTTTGAATGAACCACACCAGATCAACATTT

Reverse complement sequence

AAATGTTGATCTGGTGTGGTTCATTCAAAATATAACCGTGTTGCATATATTGTTTATCTCCAAGCTTCCAATGTAGCAGCTTGGTTTCACAAATTATGCG[T/C]
ACTATGTGAATTTCTTCTGGATCTAGTACAGTTCACATCTTTCACCCTCAAATTTATTTTTTTCTCAAAAAATAGGAAGTACTGTGCTTCGATGTTTACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 41.60% 0.11% 0.40% NA
All Indica  2759 70.40% 29.00% 0.11% 0.54% NA
All Japonica  1512 43.30% 56.50% 0.07% 0.13% NA
Aus  269 1.10% 98.50% 0.00% 0.37% NA
Indica I  595 45.70% 53.90% 0.17% 0.17% NA
Indica II  465 50.30% 48.80% 0.00% 0.86% NA
Indica III  913 88.80% 10.60% 0.11% 0.44% NA
Indica Intermediate  786 79.50% 19.60% 0.13% 0.76% NA
Temperate Japonica  767 17.50% 82.40% 0.13% 0.00% NA
Tropical Japonica  504 64.10% 35.50% 0.00% 0.40% NA
Japonica Intermediate  241 81.70% 18.30% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 7.30% 0.00% 1.04% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315003502 A -> DEL N N silent_mutation Average:53.845; most accessible tissue: Callus, score: 72.478 N N N N
vg0315003502 A -> G LOC_Os03g26229.1 upstream_gene_variant ; 2393.0bp to feature; MODIFIER silent_mutation Average:53.845; most accessible tissue: Callus, score: 72.478 N N N N
vg0315003502 A -> G LOC_Os03g26210.1 downstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:53.845; most accessible tissue: Callus, score: 72.478 N N N N
vg0315003502 A -> G LOC_Os03g26210.3 downstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:53.845; most accessible tissue: Callus, score: 72.478 N N N N
vg0315003502 A -> G LOC_Os03g26210.2 downstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:53.845; most accessible tissue: Callus, score: 72.478 N N N N
vg0315003502 A -> G LOC_Os03g26220.1 intron_variant ; MODIFIER silent_mutation Average:53.845; most accessible tissue: Callus, score: 72.478 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315003502 9.79E-06 9.79E-06 mr1030 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 7.25E-09 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 9.31E-06 9.31E-06 mr1053 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 1.90E-06 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 3.91E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 6.70E-06 6.70E-06 mr1169 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 4.20E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 5.43E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 6.22E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 1.67E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 6.96E-06 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 2.86E-08 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 9.74E-08 mr1289 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 4.78E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 1.58E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 2.22E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 5.89E-06 5.89E-06 mr1366 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 6.99E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 8.14E-06 8.14E-06 mr1393 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 4.82E-06 4.82E-06 mr1412 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 4.93E-06 4.93E-06 mr1430 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 6.96E-06 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 2.60E-09 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 7.57E-07 7.57E-07 mr1556 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 5.55E-07 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 7.14E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 2.17E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 1.29E-06 1.47E-07 mr1683 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 5.70E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 2.82E-06 3.64E-11 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 8.76E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 5.00E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 1.08E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 1.27E-07 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502 NA 5.77E-06 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251