Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315003502:

Variant ID: vg0315003502 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15003502
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAAACATCGAAGCACAGTACTTCCTATTTTTTGAGAAAAAAATAAATTTGAGGGTGAAAGATGTGAACTGTACTAGATCCAGAAGAAATTCACATAGT[A/G]
CGCATAATTTGTGAAACCAAGCTGCTACATTGGAAGCTTGGAGATAAACAATATATGCAACACGGTTATATTTTGAATGAACCACACCAGATCAACATTT

Reverse complement sequence

AAATGTTGATCTGGTGTGGTTCATTCAAAATATAACCGTGTTGCATATATTGTTTATCTCCAAGCTTCCAATGTAGCAGCTTGGTTTCACAAATTATGCG[T/C]
ACTATGTGAATTTCTTCTGGATCTAGTACAGTTCACATCTTTCACCCTCAAATTTATTTTTTTCTCAAAAAATAGGAAGTACTGTGCTTCGATGTTTACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.90%	41.60%	0.11%	0.40%	NA
All Indica	2759	70.40%	29.00%	0.11%	0.54%	NA
All Japonica	1512	43.30%	56.50%	0.07%	0.13%	NA
Aus	269	1.10%	98.50%	0.00%	0.37%	NA
Indica I	595	45.70%	53.90%	0.17%	0.17%	NA
Indica II	465	50.30%	48.80%	0.00%	0.86%	NA
Indica III	913	88.80%	10.60%	0.11%	0.44%	NA
Indica Intermediate	786	79.50%	19.60%	0.13%	0.76%	NA
Temperate Japonica	767	17.50%	82.40%	0.13%	0.00%	NA
Tropical Japonica	504	64.10%	35.50%	0.00%	0.40%	NA
Japonica Intermediate	241	81.70%	18.30%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	7.30%	0.00%	1.04%	NA
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315003502	A -> DEL	N	N	silent_mutation	Average:53.845; most accessible tissue: Callus, score: 72.478	N	N	N	N
vg0315003502	A -> G	LOC_Os03g26229.1	upstream_gene_variant ; 2393.0bp to feature; MODIFIER	silent_mutation	Average:53.845; most accessible tissue: Callus, score: 72.478	N	N	N	N
vg0315003502	A -> G	LOC_Os03g26210.1	downstream_gene_variant ; 1297.0bp to feature; MODIFIER	silent_mutation	Average:53.845; most accessible tissue: Callus, score: 72.478	N	N	N	N
vg0315003502	A -> G	LOC_Os03g26210.3	downstream_gene_variant ; 1297.0bp to feature; MODIFIER	silent_mutation	Average:53.845; most accessible tissue: Callus, score: 72.478	N	N	N	N
vg0315003502	A -> G	LOC_Os03g26210.2	downstream_gene_variant ; 1297.0bp to feature; MODIFIER	silent_mutation	Average:53.845; most accessible tissue: Callus, score: 72.478	N	N	N	N
vg0315003502	A -> G	LOC_Os03g26220.1	intron_variant ; MODIFIER	silent_mutation	Average:53.845; most accessible tissue: Callus, score: 72.478	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315003502	9.79E-06	9.79E-06	mr1030	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	7.25E-09	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	9.31E-06	9.31E-06	mr1053	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	1.90E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	3.91E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	6.70E-06	6.70E-06	mr1169	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	4.20E-06	mr1170	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	5.43E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	6.22E-07	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	1.67E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	6.96E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	2.86E-08	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	9.74E-08	mr1289	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	4.78E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	1.58E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	2.22E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	5.89E-06	5.89E-06	mr1366	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	6.99E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	8.14E-06	8.14E-06	mr1393	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	4.82E-06	4.82E-06	mr1412	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	4.93E-06	4.93E-06	mr1430	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	6.96E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	2.60E-09	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	7.57E-07	7.57E-07	mr1556	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	5.55E-07	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	7.14E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	2.17E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	1.29E-06	1.47E-07	mr1683	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	5.70E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	2.82E-06	3.64E-11	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	8.76E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	5.00E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	1.08E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	1.27E-07	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315003502	NA	5.77E-06	mr1982	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251