Variant ID: vg0314985097 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 14985097 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 101. )
TGAAAAAAATAAAAGATAAAGTAACTTCTAATCATTATATTAATAAATTACTCTCTTTGTTCCTGATATTTGACGTCGTTGACTTTTTTTAAATATGTTT[A/G]
ACCGTTCGTCTTATTAAAAAATTAAGTAATTATTAATTCTTTTTCTATCATTTGATTCATTGTTAAATATATACTTTTATGTATACATATAGTTTTACAT
ATGTAAAACTATATGTATACATAAAAGTATATATTTAACAATGAATCAAATGATAGAAAAAGAATTAATAATTACTTAATTTTTTAATAAGACGAACGGT[T/C]
AAACATATTTAAAAAAAGTCAACGACGTCAAATATCAGGAACAAAGAGAGTAATTTATTAATATAATGATTAGAAGTTACTTTATCTTTTATTTTTTTCA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 50.80% | 0.30% | 2.92% | 46.00% | NA |
All Indica | 2759 | 29.60% | 0.40% | 4.35% | 65.60% | NA |
All Japonica | 1512 | 79.00% | 0.10% | 1.12% | 19.78% | NA |
Aus | 269 | 98.90% | 0.00% | 0.00% | 1.12% | NA |
Indica I | 595 | 50.30% | 0.20% | 1.51% | 48.07% | NA |
Indica II | 465 | 43.40% | 0.40% | 4.73% | 51.40% | NA |
Indica III | 913 | 14.60% | 0.40% | 6.02% | 78.97% | NA |
Indica Intermediate | 786 | 23.40% | 0.50% | 4.33% | 71.76% | NA |
Temperate Japonica | 767 | 96.30% | 0.00% | 0.00% | 3.65% | NA |
Tropical Japonica | 504 | 53.80% | 0.20% | 2.98% | 43.06% | NA |
Japonica Intermediate | 241 | 76.30% | 0.40% | 0.83% | 22.41% | NA |
VI/Aromatic | 96 | 66.70% | 0.00% | 0.00% | 33.33% | NA |
Intermediate | 90 | 65.60% | 0.00% | 1.11% | 33.33% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0314985097 | A -> DEL | N | N | silent_mutation | Average:18.942; most accessible tissue: Callus, score: 25.377 | N | N | N | N |
vg0314985097 | A -> G | LOC_Os03g26180.1 | downstream_gene_variant ; 3313.0bp to feature; MODIFIER | silent_mutation | Average:18.942; most accessible tissue: Callus, score: 25.377 | N | N | N | N |
vg0314985097 | A -> G | LOC_Os03g26130-LOC_Os03g26180 | intergenic_region ; MODIFIER | silent_mutation | Average:18.942; most accessible tissue: Callus, score: 25.377 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0314985097 | NA | 3.52E-06 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314985097 | NA | 6.83E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314985097 | NA | 9.24E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314985097 | NA | 1.31E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314985097 | 4.59E-06 | 9.95E-06 | mr1671 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314985097 | NA | 1.02E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |