\
| Variant ID: vg0314910245 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14910245 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 336. )
CATGATGAGTTTTGAAAGCGGTTTTAAACTCATCCTGTTCCACCATACGGATTTGATGATAACCGGCTCTCAAGTCCAGTTTAGAGAAGTATTGTGTGCC[C/T]
GCTAACTCATCCAATAACTCATCAACCACTGGCATTGGAAACTTACTCTTAACAGTGACAGAGTTGAGTTTGCGATAATCCACACAAAAACGCCATGTCC
GGACATGGCGTTTTTGTGTGGATTATCGCAAACTCAACTCTGTCACTGTTAAGAGTAAGTTTCCAATGCCAGTGGTTGATGAGTTATTGGATGAGTTAGC[G/A]
GGCACACAATACTTCTCTAAACTGGACTTGAGAGCCGGTTATCATCAAATCCGTATGGTGGAACAGGATGAGTTTAAAACCGCTTTCAAAACTCATCATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.70% | 20.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 69.30% | 30.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 42.40% | 57.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 73.00% | 26.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314910245 | C -> T | LOC_Os03g26020.1 | synonymous_variant ; p.Ala625Ala; LOW | synonymous_codon | Average:31.678; most accessible tissue: Zhenshan97 root, score: 47.644 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314910245 | NA | 3.52E-06 | mr1376 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | NA | 3.52E-06 | mr1431 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | NA | 6.60E-07 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | 3.66E-06 | 9.11E-07 | mr1500 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | 6.25E-07 | 7.01E-08 | mr1500 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | 4.95E-06 | 3.05E-07 | mr1505 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | 9.74E-09 | NA | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | 4.89E-07 | 6.05E-07 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | NA | 6.97E-06 | mr1634 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | 4.62E-06 | 4.62E-06 | mr1954 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | NA | 2.16E-07 | mr1959 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | 4.43E-08 | NA | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | 1.13E-07 | 1.09E-07 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314910245 | NA | 7.73E-06 | mr1671_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |