| Variant ID: vg0314830047 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14830047 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 295. )
TCAGGATTTGAACTTAGTGAGTGAAGACATCTATCCACAACTCCACCGTAACAGCACGGTGTTTATAAGGACAAGTGATATTTCACTTGTTAGGGCTTTT[C/G]
ACAGTGTGATTAGGTGTCATTCTACCCCCAACGAGCTATGTCAAAGATTCTATGCCACGTCTGCGTCCCTCGTTACTCTGCGAAGTACGCGGATCCTAGT
ACTAGGATCCGCGTACTTCGCAGAGTAACGAGGGACGCAGACGTGGCATAGAATCTTTGACATAGCTCGTTGGGGGTAGAATGACACCTAATCACACTGT[G/C]
AAAAGCCCTAACAAGTGAAATATCACTTGTCCTTATAAACACCGTGCTGTTACGGTGGAGTTGTGGATAGATGTCTTCACTCACTAAGTTCAAATCCTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 47.40% | 1.23% | 0.08% | NA |
| All Indica | 2759 | 28.40% | 70.20% | 1.27% | 0.14% | NA |
| All Japonica | 1512 | 85.70% | 13.00% | 1.26% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 53.60% | 45.50% | 0.67% | 0.17% | NA |
| Indica II | 465 | 40.60% | 57.80% | 1.08% | 0.43% | NA |
| Indica III | 913 | 11.10% | 88.60% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 22.30% | 74.70% | 2.93% | 0.13% | NA |
| Temperate Japonica | 767 | 96.50% | 1.40% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 76.40% | 23.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 27.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 66.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 44.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314830047 | C -> DEL | N | N | silent_mutation | Average:59.542; most accessible tissue: Callus, score: 82.142 | N | N | N | N |
| vg0314830047 | C -> G | LOC_Os03g25910.1 | upstream_gene_variant ; 2209.0bp to feature; MODIFIER | silent_mutation | Average:59.542; most accessible tissue: Callus, score: 82.142 | N | N | N | N |
| vg0314830047 | C -> G | LOC_Os03g25900-LOC_Os03g25910 | intergenic_region ; MODIFIER | silent_mutation | Average:59.542; most accessible tissue: Callus, score: 82.142 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314830047 | NA | 6.83E-06 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314830047 | NA | 3.66E-06 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314830047 | 5.39E-07 | NA | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314830047 | 1.18E-08 | 2.80E-10 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314830047 | 3.00E-06 | 3.00E-06 | mr1670 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314830047 | 5.25E-08 | NA | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314830047 | 8.68E-10 | 6.01E-12 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314830047 | NA | 7.32E-07 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |