\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314830047:

Variant ID: vg0314830047 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14830047
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGGATTTGAACTTAGTGAGTGAAGACATCTATCCACAACTCCACCGTAACAGCACGGTGTTTATAAGGACAAGTGATATTTCACTTGTTAGGGCTTTT[C/G]
ACAGTGTGATTAGGTGTCATTCTACCCCCAACGAGCTATGTCAAAGATTCTATGCCACGTCTGCGTCCCTCGTTACTCTGCGAAGTACGCGGATCCTAGT

Reverse complement sequence

ACTAGGATCCGCGTACTTCGCAGAGTAACGAGGGACGCAGACGTGGCATAGAATCTTTGACATAGCTCGTTGGGGGTAGAATGACACCTAATCACACTGT[G/C]
AAAAGCCCTAACAAGTGAAATATCACTTGTCCTTATAAACACCGTGCTGTTACGGTGGAGTTGTGGATAGATGTCTTCACTCACTAAGTTCAAATCCTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 47.40% 1.23% 0.08% NA
All Indica  2759 28.40% 70.20% 1.27% 0.14% NA
All Japonica  1512 85.70% 13.00% 1.26% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 53.60% 45.50% 0.67% 0.17% NA
Indica II  465 40.60% 57.80% 1.08% 0.43% NA
Indica III  913 11.10% 88.60% 0.33% 0.00% NA
Indica Intermediate  786 22.30% 74.70% 2.93% 0.13% NA
Temperate Japonica  767 96.50% 1.40% 2.09% 0.00% NA
Tropical Japonica  504 76.40% 23.60% 0.00% 0.00% NA
Japonica Intermediate  241 71.00% 27.80% 1.24% 0.00% NA
VI/Aromatic  96 32.30% 66.70% 1.04% 0.00% NA
Intermediate  90 52.20% 44.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314830047 C -> DEL N N silent_mutation Average:59.542; most accessible tissue: Callus, score: 82.142 N N N N
vg0314830047 C -> G LOC_Os03g25910.1 upstream_gene_variant ; 2209.0bp to feature; MODIFIER silent_mutation Average:59.542; most accessible tissue: Callus, score: 82.142 N N N N
vg0314830047 C -> G LOC_Os03g25900-LOC_Os03g25910 intergenic_region ; MODIFIER silent_mutation Average:59.542; most accessible tissue: Callus, score: 82.142 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314830047 NA 6.83E-06 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314830047 NA 3.66E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314830047 5.39E-07 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314830047 1.18E-08 2.80E-10 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314830047 3.00E-06 3.00E-06 mr1670 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314830047 5.25E-08 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314830047 8.68E-10 6.01E-12 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314830047 NA 7.32E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251