\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314825168:

Variant ID: vg0314825168 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14825168
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACACACTTAATTTGCTTGGCCTCGGTTTGCGTGCCAAACCGACGGACCTACCCAGTAGTCGCACTAATTCCTGTAGATTGTACTACCCTGATTCCTTG[C/T]
CGCTCCACCCTTGTGGTACTTCCGTATCCGTGCTCTCTGAGCGCGTATACCAAATATCCCACATACACCGTTGACTGTCGAAAAATTGGGAAATGGGTTT

Reverse complement sequence

AAACCCATTTCCCAATTTTTCGACAGTCAACGGTGTATGTGGGATATTTGGTATACGCGCTCAGAGAGCACGGATACGGAAGTACCACAAGGGTGGAGCG[G/A]
CAAGGAATCAGGGTAGTACAATCTACAGGAATTAGTGCGACTACTGGGTAGGTCCGTCGGTTTGGCACGCAAACCGAGGCCAAGCAAATTAAGTGTGTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 7.30% 2.90% 17.14% NA
All Indica  2759 75.70% 0.40% 2.68% 21.28% NA
All Japonica  1512 79.40% 19.70% 0.00% 0.93% NA
Aus  269 5.60% 1.10% 21.93% 71.38% NA
Indica I  595 55.80% 0.50% 3.19% 40.50% NA
Indica II  465 60.60% 1.30% 4.30% 33.76% NA
Indica III  913 91.30% 0.00% 2.41% 6.24% NA
Indica Intermediate  786 81.40% 0.10% 1.65% 16.79% NA
Temperate Japonica  767 96.70% 3.10% 0.00% 0.13% NA
Tropical Japonica  504 54.80% 43.30% 0.00% 1.98% NA
Japonica Intermediate  241 75.50% 23.20% 0.00% 1.24% NA
VI/Aromatic  96 70.80% 24.00% 1.04% 4.17% NA
Intermediate  90 68.90% 13.30% 3.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314825168 C -> T LOC_Os03g25900.1 downstream_gene_variant ; 3184.0bp to feature; MODIFIER silent_mutation Average:39.46; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0314825168 C -> T LOC_Os03g25900-LOC_Os03g25910 intergenic_region ; MODIFIER silent_mutation Average:39.46; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0314825168 C -> DEL N N silent_mutation Average:39.46; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314825168 NA 3.76E-16 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314825168 NA 4.15E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 1.33E-07 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 8.78E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 1.94E-07 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 6.12E-06 1.82E-09 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 5.34E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 2.44E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 1.33E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 2.56E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 4.41E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 1.43E-07 NA mr1542_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 3.32E-06 2.27E-10 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 9.88E-07 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 2.22E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 3.66E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 9.80E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 9.65E-07 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 4.97E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 1.30E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 1.06E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825168 NA 3.68E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251