\
| Variant ID: vg0314825168 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14825168 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCACACACTTAATTTGCTTGGCCTCGGTTTGCGTGCCAAACCGACGGACCTACCCAGTAGTCGCACTAATTCCTGTAGATTGTACTACCCTGATTCCTTG[C/T]
CGCTCCACCCTTGTGGTACTTCCGTATCCGTGCTCTCTGAGCGCGTATACCAAATATCCCACATACACCGTTGACTGTCGAAAAATTGGGAAATGGGTTT
AAACCCATTTCCCAATTTTTCGACAGTCAACGGTGTATGTGGGATATTTGGTATACGCGCTCAGAGAGCACGGATACGGAAGTACCACAAGGGTGGAGCG[G/A]
CAAGGAATCAGGGTAGTACAATCTACAGGAATTAGTGCGACTACTGGGTAGGTCCGTCGGTTTGGCACGCAAACCGAGGCCAAGCAAATTAAGTGTGTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.60% | 7.30% | 2.90% | 17.14% | NA |
| All Indica | 2759 | 75.70% | 0.40% | 2.68% | 21.28% | NA |
| All Japonica | 1512 | 79.40% | 19.70% | 0.00% | 0.93% | NA |
| Aus | 269 | 5.60% | 1.10% | 21.93% | 71.38% | NA |
| Indica I | 595 | 55.80% | 0.50% | 3.19% | 40.50% | NA |
| Indica II | 465 | 60.60% | 1.30% | 4.30% | 33.76% | NA |
| Indica III | 913 | 91.30% | 0.00% | 2.41% | 6.24% | NA |
| Indica Intermediate | 786 | 81.40% | 0.10% | 1.65% | 16.79% | NA |
| Temperate Japonica | 767 | 96.70% | 3.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 54.80% | 43.30% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 75.50% | 23.20% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 70.80% | 24.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 68.90% | 13.30% | 3.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314825168 | C -> T | LOC_Os03g25900.1 | downstream_gene_variant ; 3184.0bp to feature; MODIFIER | silent_mutation | Average:39.46; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0314825168 | C -> T | LOC_Os03g25900-LOC_Os03g25910 | intergenic_region ; MODIFIER | silent_mutation | Average:39.46; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0314825168 | C -> DEL | N | N | silent_mutation | Average:39.46; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314825168 | NA | 3.76E-16 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314825168 | NA | 4.15E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 1.33E-07 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 8.78E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | 1.94E-07 | NA | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | 6.12E-06 | 1.82E-09 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 5.34E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 2.44E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 1.33E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 2.56E-08 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 4.41E-13 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | 1.43E-07 | NA | mr1542_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | 3.32E-06 | 2.27E-10 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 9.88E-07 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 2.22E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 3.66E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 9.80E-06 | mr1830_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 9.65E-07 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 4.97E-08 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 1.30E-10 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 1.06E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314825168 | NA | 3.68E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |