Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314756039:

Variant ID: vg0314756039 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14756039
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

GATTCCGTCGGTTACGGAATTAAACACACGGAGAATTGATTTCGTATCAATGAACACATTGGTTACGGAATTAAATGTCGTGAATTGATTCCGTCGGTTA[C/T]
GGAATTAAACGTCGTGAATTGATTCCGTATTAACGAGCGCGTCGGTTACGAAATTAAACACCGTGGTTGATGATTCCGAACGTTACTCCCACGCTCGTAT

Reverse complement sequence

ATACGAGCGTGGGAGTAACGTTCGGAATCATCAACCACGGTGTTTAATTTCGTAACCGACGCGCTCGTTAATACGGAATCAATTCACGACGTTTAATTCC[G/A]
TAACCGACGGAATCAATTCACGACATTTAATTCCGTAACCAATGTGTTCATTGATACGAAATCAATTCTCCGTGTGTTTAATTCCGTAACCGACGGAATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	6.60%	0.93%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.14%	0.00%	NA
All Japonica	1512	77.10%	20.20%	2.65%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	57.60%	37.30%	5.08%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	94.20%	5.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314756039	C -> T	LOC_Os03g25770.1	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:54.415; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0314756039	C -> T	LOC_Os03g25790.1	upstream_gene_variant ; 3813.0bp to feature; MODIFIER	silent_mutation	Average:54.415; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0314756039	C -> T	LOC_Os03g25770.2	upstream_gene_variant ; 1126.0bp to feature; MODIFIER	silent_mutation	Average:54.415; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0314756039	C -> T	LOC_Os03g25790.2	upstream_gene_variant ; 3822.0bp to feature; MODIFIER	silent_mutation	Average:54.415; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0314756039	C -> T	LOC_Os03g25770-LOC_Os03g25790	intergenic_region ; MODIFIER	silent_mutation	Average:54.415; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314756039	NA	9.88E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	6.41E-07	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	8.11E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	6.35E-06	2.71E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	7.51E-08	1.30E-32	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	5.17E-13	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	1.07E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	9.08E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	5.26E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	3.90E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	5.72E-06	NA	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	3.97E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	2.05E-08	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	4.32E-06	NA	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	1.41E-09	1.17E-30	mr1617	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	2.49E-12	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	1.36E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	2.16E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	1.35E-06	NA	mr1737	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	7.22E-08	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	1.14E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	3.52E-08	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	6.40E-06	NA	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	1.45E-10	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	2.30E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314756039	NA	4.08E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251