\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314727170:

Variant ID: vg0314727170 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14727170
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCGTGCTTGACTTTACTCGGCTGTCCTCCTCTAGGGTTTGCTGTATGTACTGGGTTTATTGGGCTTCCTAGGCCTATTGGGCCACAATTCGGTTTTCT[C/T]
GGTTAATTCGGTTAACCGAAGCCTATAACCGAATTACCAAAAAAATCCGGTCTTTCGATGGCTGAGACCGAACTACTAACCAAATTTCTCGATCTCGGTC

Reverse complement sequence

GACCGAGATCGAGAAATTTGGTTAGTAGTTCGGTCTCAGCCATCGAAAGACCGGATTTTTTTGGTAATTCGGTTATAGGCTTCGGTTAACCGAATTAACC[G/A]
AGAAAACCGAATTGTGGCCCAATAGGCCTAGGAAGCCCAATAAACCCAGTACATACAGCAAACCCTAGAGGAGGACAGCCGAGTAAAGTCAAGCACGCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 29.50% 6.01% 13.88% NA
All Indica  2759 35.30% 39.40% 7.07% 18.23% NA
All Japonica  1512 77.80% 18.30% 3.11% 0.79% NA
Aus  269 38.70% 1.50% 13.75% 46.10% NA
Indica I  595 29.40% 40.70% 8.91% 21.01% NA
Indica II  465 30.80% 20.90% 15.27% 33.12% NA
Indica III  913 40.00% 50.60% 1.20% 8.21% NA
Indica Intermediate  786 36.90% 36.50% 7.63% 18.96% NA
Temperate Japonica  767 60.80% 33.10% 6.00% 0.13% NA
Tropical Japonica  504 96.60% 1.60% 0.00% 1.79% NA
Japonica Intermediate  241 92.90% 5.80% 0.41% 0.83% NA
VI/Aromatic  96 87.50% 6.20% 1.04% 5.21% NA
Intermediate  90 58.90% 23.30% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314727170 C -> T LOC_Os03g25720.1 upstream_gene_variant ; 1916.0bp to feature; MODIFIER silent_mutation Average:90.66; most accessible tissue: Zhenshan97 young leaf, score: 97.075 N N N N
vg0314727170 C -> T LOC_Os03g25750.1 upstream_gene_variant ; 1602.0bp to feature; MODIFIER silent_mutation Average:90.66; most accessible tissue: Zhenshan97 young leaf, score: 97.075 N N N N
vg0314727170 C -> T LOC_Os03g25720-LOC_Os03g25750 intergenic_region ; MODIFIER silent_mutation Average:90.66; most accessible tissue: Zhenshan97 young leaf, score: 97.075 N N N N
vg0314727170 C -> DEL N N silent_mutation Average:90.66; most accessible tissue: Zhenshan97 young leaf, score: 97.075 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0314727170 C T 0.01 0.0 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314727170 NA 3.94E-12 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 1.92E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 5.81E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 2.73E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 1.03E-06 NA mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 3.03E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 4.41E-08 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 3.05E-09 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 2.71E-08 2.55E-19 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 2.54E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 7.50E-11 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 6.72E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 9.75E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 4.75E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 1.37E-06 NA mr1737 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 3.65E-06 mr1748 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 7.69E-06 NA mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 3.55E-07 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 5.43E-06 NA mr1955 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 8.55E-06 8.55E-06 mr1955 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 3.35E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 3.43E-06 4.30E-06 mr1992 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 6.89E-06 6.89E-06 mr1992 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 1.39E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 6.62E-08 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 1.67E-09 1.42E-19 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 5.36E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314727170 NA 8.99E-06 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251