Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0314702972:

Variant ID: vg0314702972 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14702972
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.13, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTCTTTGTTTAGGTTTTTGATTGTTTGCGCCTAGTTGTGGTTACCGGATATTTTTCTTCAAGCGGATTTCTCGAAGATTTGTGAAGCTTCGTGAAGAC[T/C]
CTGAGCAAGGCAAGCCACCTTTGAACATATTGAGCCTATATTTGAACTTAACTAGTTGAATCCCCACGCGTTGCTGCGGGCTTAATAAGTTATTTCAAAC

Reverse complement sequence

GTTTGAAATAACTTATTAAGCCCGCAGCAACGCGTGGGGATTCAACTAGTTAAGTTCAAATATAGGCTCAATATGTTCAAAGGTGGCTTGCCTTGCTCAG[A/G]
GTCTTCACGAAGCTTCACAAATCTTCGAGAAATCCGCTTGAAGAAAAATATCCGGTAACCACAACTAGGCGCAAACAATCAAAAACCTAAACAAAGACCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	24.30%	0.80%	24.80%	NA
All Indica	2759	26.50%	40.60%	1.16%	31.79%	NA
All Japonica	1512	98.60%	0.30%	0.07%	1.06%	NA
Aus	269	3.00%	1.50%	1.12%	94.42%	NA
Indica I	595	23.00%	41.70%	1.51%	33.78%	NA
Indica II	465	12.50%	21.10%	2.15%	64.30%	NA
Indica III	913	35.50%	52.50%	0.22%	11.83%	NA
Indica Intermediate	786	27.00%	37.40%	1.40%	34.22%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	97.20%	0.60%	0.00%	2.18%	NA
Japonica Intermediate	241	97.90%	0.40%	0.41%	1.24%	NA
VI/Aromatic	96	88.50%	5.20%	0.00%	6.25%	NA
Intermediate	90	57.80%	18.90%	2.22%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314702972	T -> C	LOC_Os03g25680.1	upstream_gene_variant ; 4088.0bp to feature; MODIFIER	silent_mutation	Average:66.154; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N
vg0314702972	T -> C	LOC_Os03g25690.1	upstream_gene_variant ; 995.0bp to feature; MODIFIER	silent_mutation	Average:66.154; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N
vg0314702972	T -> C	LOC_Os03g25690-LOC_Os03g25700	intergenic_region ; MODIFIER	silent_mutation	Average:66.154; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N
vg0314702972	T -> DEL	N	N	silent_mutation	Average:66.154; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314702972	2.30E-07	7.85E-10	mr1319_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251