Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314656096:

Variant ID: vg0314656096 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14656096
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTGATAATATATTTGTTTTGTATATAAAAGATTACTATAATTTTTTTATAAACTTGATTAAACTAAAAAAATATTGGATTAGAAAAAAAAATCAAAC[G/A]
ACTTGTAATATTGGATTAGAAAATAAAATCAAAACGACGAGATACGAAATGGAGGGAGTACATTGTTTTCTAGAGCATTTTATAGAGCCTTTGCTCTTGG

Reverse complement sequence

CCAAGAGCAAAGGCTCTATAAAATGCTCTAGAAAACAATGTACTCCCTCCATTTCGTATCTCGTCGTTTTGATTTTATTTTCTAATCCAATATTACAAGT[C/T]
GTTTGATTTTTTTTTCTAATCCAATATTTTTTTAGTTTAATCAAGTTTATAAAAAAATTATAGTAATCTTTTATATACAAAACAAATATATTATCAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	5.60%	1.52%	0.00%	NA
All Indica	2759	99.80%	0.00%	0.18%	0.00%	NA
All Japonica	1512	78.30%	17.30%	4.43%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.00%	0.38%	0.00%	NA
Temperate Japonica	767	60.10%	31.40%	8.47%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	93.80%	5.40%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314656096	G -> A	LOC_Os03g25600.1	upstream_gene_variant ; 144.0bp to feature; MODIFIER	silent_mutation	Average:79.625; most accessible tissue: Minghui63 root, score: 91.896	N	N	N	N
vg0314656096	G -> A	LOC_Os03g25600.2	upstream_gene_variant ; 144.0bp to feature; MODIFIER	silent_mutation	Average:79.625; most accessible tissue: Minghui63 root, score: 91.896	N	N	N	N
vg0314656096	G -> A	LOC_Os03g25590-LOC_Os03g25600	intergenic_region ; MODIFIER	silent_mutation	Average:79.625; most accessible tissue: Minghui63 root, score: 91.896	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314656096	NA	5.71E-06	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	NA	9.79E-07	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	NA	5.29E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	NA	8.89E-11	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	5.42E-06	1.16E-08	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	NA	2.77E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	7.78E-07	2.66E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	3.61E-06	8.11E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	2.80E-06	2.80E-06	mr1430	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	4.78E-06	4.78E-06	mr1476	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	NA	7.78E-06	mr1492	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	NA	3.97E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	NA	4.16E-07	mr1576	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	3.91E-07	8.68E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	1.06E-06	4.13E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	NA	5.17E-10	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	NA	4.28E-06	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	2.23E-06	2.23E-06	mr1955	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314656096	NA	9.14E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251