\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314581119:

Variant ID: vg0314581119 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14581119
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGGGTGACCCTCTCTAGCGGGAGGCTGTGAGGCCCCCCTTTGAGAGTTCGGCCGGGGGCAGCGGGTGAGATTCGAGGATTTGGTGAGCGAAACTGTGT[G/A]
TGATCTTGATCTCGGAGGCTCCTCCAAGACGATGAGACAAAAGAGGTTTATATAGGTTCGGGCCGCTATGAAGCGTAATACCCTACTCCTGTGTGTATGA

Reverse complement sequence

TCATACACACAGGAGTAGGGTATTACGCTTCATAGCGGCCCGAACCTATATAAACCTCTTTTGTCTCATCGTCTTGGAGGAGCCTCCGAGATCAAGATCA[C/T]
ACACAGTTTCGCTCACCAAATCCTCGAATCTCACCCGCTGCCCCCGGCCGAACTCTCAAAGGGGGGCCTCACAGCCTCCCGCTAGAGAGGGTCACCCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 23.70% 0.40% 0.00% NA
All Indica  2759 69.10% 30.50% 0.40% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 8.90% 88.50% 2.60% 0.00% NA
Indica I  595 51.40% 48.10% 0.50% 0.00% NA
Indica II  465 59.40% 40.40% 0.22% 0.00% NA
Indica III  913 81.20% 18.50% 0.33% 0.00% NA
Indica Intermediate  786 74.20% 25.30% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314581119 G -> A LOC_Os03g25540.1 upstream_gene_variant ; 1596.0bp to feature; MODIFIER silent_mutation Average:46.137; most accessible tissue: Minghui63 flower, score: 65.501 N N N N
vg0314581119 G -> A LOC_Os03g25530.1 downstream_gene_variant ; 1873.0bp to feature; MODIFIER silent_mutation Average:46.137; most accessible tissue: Minghui63 flower, score: 65.501 N N N N
vg0314581119 G -> A LOC_Os03g25530-LOC_Os03g25540 intergenic_region ; MODIFIER silent_mutation Average:46.137; most accessible tissue: Minghui63 flower, score: 65.501 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314581119 NA 3.98E-09 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314581119 1.75E-08 NA mr1542_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314581119 8.31E-09 6.30E-13 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314581119 NA 1.05E-15 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314581119 2.93E-06 2.99E-08 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251