Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0314571719:

Variant ID: vg0314571719 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14571719
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

CTTCCTACTGAAAGAAATCGGCGCAAATGGAGGCTTCAGAAGAATCTCAGGGACACACTGATGCAGATCATACGATCGCGGCTATCATCAAAAGACGGCG[G/A]
GTACGGCAACGATCTGCTCGGTTTGATGCTTGGCGCCTGCGCTTCAGACGAGCAAGGGGAGGCCAGCAGCTTGAGCATGGACGAGATCGTAGACGAGTGC

Reverse complement sequence

GCACTCGTCTACGATCTCGTCCATGCTCAAGCTGCTGGCCTCCCCTTGCTCGTCTGAAGCGCAGGCGCCAAGCATCAAACCGAGCAGATCGTTGCCGTAC[C/T]
CGCCGTCTTTTGATGATAGCCGCGATCGTATGATCTGCATCAGTGTGTCCCTGAGATTCTTCTGAAGCCTCCATTTGCGCCGATTTCTTTCAGTAGGAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.40%	31.90%	0.19%	0.53%	NA
All Indica	2759	52.60%	46.30%	0.22%	0.87%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	30.10%	69.10%	0.74%	0.00%	NA
Indica I	595	49.10%	49.40%	0.67%	0.84%	NA
Indica II	465	20.40%	78.50%	0.00%	1.08%	NA
Indica III	913	75.90%	23.50%	0.00%	0.55%	NA
Indica Intermediate	786	47.30%	51.30%	0.25%	1.15%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	64.40%	33.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314571719	G -> A	LOC_Os03g25500.1	3_prime_UTR_variant ; 339.0bp to feature; MODIFIER	silent_mutation	Average:72.345; most accessible tissue: Zhenshan97 flower, score: 84.504	N	N	N	N
vg0314571719	G -> A	LOC_Os03g25510.1	downstream_gene_variant ; 2811.0bp to feature; MODIFIER	silent_mutation	Average:72.345; most accessible tissue: Zhenshan97 flower, score: 84.504	N	N	N	N
vg0314571719	G -> DEL	N	N	silent_mutation	Average:72.345; most accessible tissue: Zhenshan97 flower, score: 84.504	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314571719	1.57E-78	5.47E-168	mr1542	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719	1.25E-62	7.34E-105	mr1542	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719	NA	1.04E-06	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719	NA	7.20E-09	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719	NA	1.83E-08	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719	4.67E-06	4.31E-19	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719	3.01E-87	1.25E-196	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719	6.99E-88	7.44E-131	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719	1.81E-17	1.28E-29	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719	2.81E-12	6.45E-14	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251