\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314571719:

Variant ID: vg0314571719 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14571719
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCCTACTGAAAGAAATCGGCGCAAATGGAGGCTTCAGAAGAATCTCAGGGACACACTGATGCAGATCATACGATCGCGGCTATCATCAAAAGACGGCG[G/A]
GTACGGCAACGATCTGCTCGGTTTGATGCTTGGCGCCTGCGCTTCAGACGAGCAAGGGGAGGCCAGCAGCTTGAGCATGGACGAGATCGTAGACGAGTGC

Reverse complement sequence

GCACTCGTCTACGATCTCGTCCATGCTCAAGCTGCTGGCCTCCCCTTGCTCGTCTGAAGCGCAGGCGCCAAGCATCAAACCGAGCAGATCGTTGCCGTAC[C/T]
CGCCGTCTTTTGATGATAGCCGCGATCGTATGATCTGCATCAGTGTGTCCCTGAGATTCTTCTGAAGCCTCCATTTGCGCCGATTTCTTTCAGTAGGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 31.90% 0.19% 0.53% NA
All Indica  2759 52.60% 46.30% 0.22% 0.87% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 30.10% 69.10% 0.74% 0.00% NA
Indica I  595 49.10% 49.40% 0.67% 0.84% NA
Indica II  465 20.40% 78.50% 0.00% 1.08% NA
Indica III  913 75.90% 23.50% 0.00% 0.55% NA
Indica Intermediate  786 47.30% 51.30% 0.25% 1.15% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314571719 G -> A LOC_Os03g25500.1 3_prime_UTR_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:72.345; most accessible tissue: Zhenshan97 flower, score: 84.504 N N N N
vg0314571719 G -> A LOC_Os03g25510.1 downstream_gene_variant ; 2811.0bp to feature; MODIFIER silent_mutation Average:72.345; most accessible tissue: Zhenshan97 flower, score: 84.504 N N N N
vg0314571719 G -> DEL N N silent_mutation Average:72.345; most accessible tissue: Zhenshan97 flower, score: 84.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314571719 1.57E-78 5.47E-168 mr1542 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719 1.25E-62 7.34E-105 mr1542 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719 NA 1.04E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719 NA 7.20E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719 NA 1.83E-08 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719 4.67E-06 4.31E-19 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719 3.01E-87 1.25E-196 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719 6.99E-88 7.44E-131 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719 1.81E-17 1.28E-29 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314571719 2.81E-12 6.45E-14 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251