Variant ID: vg0314553734 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 14553734 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 119. )
CGGATTCCAGCCACTCCGGTCATCACCGGCATCGACAATTGAATGAATGATCAAACTCCATCACAAGAAATTTCTGGGGTTTTTTTTTTTGTTGTTAAAA[G/A]
CACAAGGACATGAAGAATAATTATATTGTTTTCATATAGCCTTTTTTTAACGAAAGATGTTTTCATGCCTTCTTTGCTAGGATCTTGTCTCAGGCGGTCA
TGACCGCCTGAGACAAGATCCTAGCAAAGAAGGCATGAAAACATCTTTCGTTAAAAAAAGGCTATATGAAAACAATATAATTATTCTTCATGTCCTTGTG[C/T]
TTTTAACAACAAAAAAAAAAACCCCAGAAATTTCTTGTGATGGAGTTTGATCATTCATTCAATTGTCGATGCCGGTGATGACCGGAGTGGCTGGAATCCG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 89.00% | 11.00% | 0.00% | 0.00% | NA |
All Indica | 2759 | 85.80% | 14.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 57.60% | 42.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
Indica II | 465 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 81.60% | 18.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0314553734 | G -> A | LOC_Os03g25460.1 | upstream_gene_variant ; 4126.0bp to feature; MODIFIER | silent_mutation | Average:68.324; most accessible tissue: Callus, score: 91.215 | N | N | N | N |
vg0314553734 | G -> A | LOC_Os03g25464.1 | upstream_gene_variant ; 2541.0bp to feature; MODIFIER | silent_mutation | Average:68.324; most accessible tissue: Callus, score: 91.215 | N | N | N | N |
vg0314553734 | G -> A | LOC_Os03g25470.1 | downstream_gene_variant ; 985.0bp to feature; MODIFIER | silent_mutation | Average:68.324; most accessible tissue: Callus, score: 91.215 | N | N | N | N |
vg0314553734 | G -> A | LOC_Os03g25480.1 | intron_variant ; MODIFIER | silent_mutation | Average:68.324; most accessible tissue: Callus, score: 91.215 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0314553734 | NA | 4.74E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | NA | 1.42E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | NA | 5.30E-07 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | NA | 9.58E-06 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | NA | 2.13E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | NA | 1.77E-06 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | 8.71E-16 | NA | mr1542 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | 3.98E-10 | NA | mr1542 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | NA | 1.15E-07 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | 5.94E-17 | NA | mr1542_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | 9.76E-12 | NA | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314553734 | NA | 3.78E-11 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |