\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314553734:

Variant ID: vg0314553734 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14553734
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


CGGATTCCAGCCACTCCGGTCATCACCGGCATCGACAATTGAATGAATGATCAAACTCCATCACAAGAAATTTCTGGGGTTTTTTTTTTTGTTGTTAAAA[G/A]
CACAAGGACATGAAGAATAATTATATTGTTTTCATATAGCCTTTTTTTAACGAAAGATGTTTTCATGCCTTCTTTGCTAGGATCTTGTCTCAGGCGGTCA

Reverse complement sequence

TGACCGCCTGAGACAAGATCCTAGCAAAGAAGGCATGAAAACATCTTTCGTTAAAAAAAGGCTATATGAAAACAATATAATTATTCTTCATGTCCTTGTG[C/T]
TTTTAACAACAAAAAAAAAAACCCCAGAAATTTCTTGTGATGGAGTTTGATCATTCATTCAATTGTCGATGCCGGTGATGACCGGAGTGGCTGGAATCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 11.00% 0.00% 0.00% NA
All Indica  2759 85.80% 14.20% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 57.60% 42.40% 0.00% 0.00% NA
Indica I  595 87.60% 12.40% 0.00% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 84.80% 15.20% 0.00% 0.00% NA
Indica Intermediate  786 81.60% 18.40% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314553734 G -> A LOC_Os03g25460.1 upstream_gene_variant ; 4126.0bp to feature; MODIFIER silent_mutation Average:68.324; most accessible tissue: Callus, score: 91.215 N N N N
vg0314553734 G -> A LOC_Os03g25464.1 upstream_gene_variant ; 2541.0bp to feature; MODIFIER silent_mutation Average:68.324; most accessible tissue: Callus, score: 91.215 N N N N
vg0314553734 G -> A LOC_Os03g25470.1 downstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:68.324; most accessible tissue: Callus, score: 91.215 N N N N
vg0314553734 G -> A LOC_Os03g25480.1 intron_variant ; MODIFIER silent_mutation Average:68.324; most accessible tissue: Callus, score: 91.215 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314553734 NA 4.74E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 NA 1.42E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 NA 5.30E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 NA 9.58E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 NA 2.13E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 NA 1.77E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 8.71E-16 NA mr1542 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 3.98E-10 NA mr1542 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 NA 1.15E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 5.94E-17 NA mr1542_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 9.76E-12 NA mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314553734 NA 3.78E-11 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251