Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314549769:

Variant ID: vg0314549769 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14549769
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAATTTTTAGCCTCTTACTAATTAACTAGTATTGTGGCCCGCGCAAATTGCGCAGCTAGCTACCAATATTCCTTATTTTCTATTCCAAATTTTCTTTT[T/G]
TTTTTCTAAATTGTATTTTTATATAGATTGTAAACTCTTATTTCAGTATTTTTTTATTTTTTATTTTTATAAATTAAAGTTATAAATTGTATTTCTATAT

Reverse complement sequence

ATATAGAAATACAATTTATAACTTTAATTTATAAAAATAAAAAATAAAAAAATACTGAAATAAGAGTTTACAATCTATATAAAAATACAATTTAGAAAAA[A/C]
AAAAGAAAATTTGGAATAGAAAATAAGGAATATTGGTAGCTAGCTGCGCAATTTGCGCGGGCCACAATACTAGTTAATTAGTAAGAGGCTAAAAATTGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.90%	5.40%	6.03%	7.68%	NA
All Indica	2759	71.70%	9.10%	8.63%	10.58%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	62.10%	0.00%	15.61%	22.30%	NA
Indica I	595	63.00%	9.60%	17.14%	10.25%	NA
Indica II	465	87.10%	2.80%	3.87%	6.24%	NA
Indica III	913	70.90%	13.70%	5.37%	10.08%	NA
Indica Intermediate	786	70.10%	7.10%	8.78%	13.99%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	82.20%	3.30%	5.56%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314549769	T -> DEL	N	N	silent_mutation	Average:66.632; most accessible tissue: Callus, score: 90.128	N	N	N	N
vg0314549769	T -> G	LOC_Os03g25460.1	upstream_gene_variant ; 161.0bp to feature; MODIFIER	silent_mutation	Average:66.632; most accessible tissue: Callus, score: 90.128	N	N	N	N
vg0314549769	T -> G	LOC_Os03g25470.1	upstream_gene_variant ; 2429.0bp to feature; MODIFIER	silent_mutation	Average:66.632; most accessible tissue: Callus, score: 90.128	N	N	N	N
vg0314549769	T -> G	LOC_Os03g25480.1	upstream_gene_variant ; 3333.0bp to feature; MODIFIER	silent_mutation	Average:66.632; most accessible tissue: Callus, score: 90.128	N	N	N	N
vg0314549769	T -> G	LOC_Os03g25440.1	downstream_gene_variant ; 4984.0bp to feature; MODIFIER	silent_mutation	Average:66.632; most accessible tissue: Callus, score: 90.128	N	N	N	N
vg0314549769	T -> G	LOC_Os03g25450.1	downstream_gene_variant ; 1840.0bp to feature; MODIFIER	silent_mutation	Average:66.632; most accessible tissue: Callus, score: 90.128	N	N	N	N
vg0314549769	T -> G	LOC_Os03g25464.1	downstream_gene_variant ; 446.0bp to feature; MODIFIER	silent_mutation	Average:66.632; most accessible tissue: Callus, score: 90.128	N	N	N	N
vg0314549769	T -> G	LOC_Os03g25460-LOC_Os03g25464	intergenic_region ; MODIFIER	silent_mutation	Average:66.632; most accessible tissue: Callus, score: 90.128	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314549769	NA	4.23E-11	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314549769	1.04E-09	NA	mr1542_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314549769	2.05E-07	5.19E-16	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314549769	4.83E-06	8.63E-08	mr1587_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251