\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314549769:

Variant ID: vg0314549769 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14549769
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAATTTTTAGCCTCTTACTAATTAACTAGTATTGTGGCCCGCGCAAATTGCGCAGCTAGCTACCAATATTCCTTATTTTCTATTCCAAATTTTCTTTT[T/G]
TTTTTCTAAATTGTATTTTTATATAGATTGTAAACTCTTATTTCAGTATTTTTTTATTTTTTATTTTTATAAATTAAAGTTATAAATTGTATTTCTATAT

Reverse complement sequence

ATATAGAAATACAATTTATAACTTTAATTTATAAAAATAAAAAATAAAAAAATACTGAAATAAGAGTTTACAATCTATATAAAAATACAATTTAGAAAAA[A/C]
AAAAGAAAATTTGGAATAGAAAATAAGGAATATTGGTAGCTAGCTGCGCAATTTGCGCGGGCCACAATACTAGTTAATTAGTAAGAGGCTAAAAATTGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 5.40% 6.03% 7.68% NA
All Indica  2759 71.70% 9.10% 8.63% 10.58% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 62.10% 0.00% 15.61% 22.30% NA
Indica I  595 63.00% 9.60% 17.14% 10.25% NA
Indica II  465 87.10% 2.80% 3.87% 6.24% NA
Indica III  913 70.90% 13.70% 5.37% 10.08% NA
Indica Intermediate  786 70.10% 7.10% 8.78% 13.99% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 82.20% 3.30% 5.56% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314549769 T -> DEL N N silent_mutation Average:66.632; most accessible tissue: Callus, score: 90.128 N N N N
vg0314549769 T -> G LOC_Os03g25460.1 upstream_gene_variant ; 161.0bp to feature; MODIFIER silent_mutation Average:66.632; most accessible tissue: Callus, score: 90.128 N N N N
vg0314549769 T -> G LOC_Os03g25470.1 upstream_gene_variant ; 2429.0bp to feature; MODIFIER silent_mutation Average:66.632; most accessible tissue: Callus, score: 90.128 N N N N
vg0314549769 T -> G LOC_Os03g25480.1 upstream_gene_variant ; 3333.0bp to feature; MODIFIER silent_mutation Average:66.632; most accessible tissue: Callus, score: 90.128 N N N N
vg0314549769 T -> G LOC_Os03g25440.1 downstream_gene_variant ; 4984.0bp to feature; MODIFIER silent_mutation Average:66.632; most accessible tissue: Callus, score: 90.128 N N N N
vg0314549769 T -> G LOC_Os03g25450.1 downstream_gene_variant ; 1840.0bp to feature; MODIFIER silent_mutation Average:66.632; most accessible tissue: Callus, score: 90.128 N N N N
vg0314549769 T -> G LOC_Os03g25464.1 downstream_gene_variant ; 446.0bp to feature; MODIFIER silent_mutation Average:66.632; most accessible tissue: Callus, score: 90.128 N N N N
vg0314549769 T -> G LOC_Os03g25460-LOC_Os03g25464 intergenic_region ; MODIFIER silent_mutation Average:66.632; most accessible tissue: Callus, score: 90.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314549769 NA 4.23E-11 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314549769 1.04E-09 NA mr1542_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314549769 2.05E-07 5.19E-16 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314549769 4.83E-06 8.63E-08 mr1587_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251