\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314533381:

Variant ID: vg0314533381 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14533381
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.11, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ACATAGCAGTGGGCCTGTTTAGAAGAATTTAAGATTCTAAAAGTAATTGGTTGGTAACCAGTTTTTAAGAATTTAAAAAAGCTGAGTTTCCCAGCTTCTG[A/G]
CTACTAGTTTATTTTATGGATTCTACAACTACACCAATAAAAAAGTCACAACAAAGCTATCATACACGAAGAAACTAGGAGAGAGAGAAGAACATGAAAC

Reverse complement sequence

GTTTCATGTTCTTCTCTCTCTCCTAGTTTCTTCGTGTATGATAGCTTTGTTGTGACTTTTTTATTGGTGTAGTTGTAGAATCCATAAAATAAACTAGTAG[T/C]
CAGAAGCTGGGAAACTCAGCTTTTTTAAATTCTTAAAAACTGGTTACCAACCAATTACTTTTAGAATCTTAAATTCTTCTAAACAGGCCCACTGCTATGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 15.70% 0.08% 0.00% NA
All Indica  2759 86.60% 13.30% 0.14% 0.00% NA
All Japonica  1512 83.90% 16.10% 0.00% 0.00% NA
Aus  269 58.00% 42.00% 0.00% 0.00% NA
Indica I  595 89.10% 10.60% 0.34% 0.00% NA
Indica II  465 92.30% 7.70% 0.00% 0.00% NA
Indica III  913 85.70% 14.30% 0.00% 0.00% NA
Indica Intermediate  786 82.30% 17.40% 0.25% 0.00% NA
Temperate Japonica  767 81.90% 18.10% 0.00% 0.00% NA
Tropical Japonica  504 91.70% 8.30% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314533381 A -> G LOC_Os03g25410.1 upstream_gene_variant ; 2072.0bp to feature; MODIFIER silent_mutation Average:76.896; most accessible tissue: Zhenshan97 flag leaf, score: 88.606 N N N N
vg0314533381 A -> G LOC_Os03g25420.1 upstream_gene_variant ; 411.0bp to feature; MODIFIER silent_mutation Average:76.896; most accessible tissue: Zhenshan97 flag leaf, score: 88.606 N N N N
vg0314533381 A -> G LOC_Os03g25400.1 downstream_gene_variant ; 2530.0bp to feature; MODIFIER silent_mutation Average:76.896; most accessible tissue: Zhenshan97 flag leaf, score: 88.606 N N N N
vg0314533381 A -> G LOC_Os03g25430.1 downstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:76.896; most accessible tissue: Zhenshan97 flag leaf, score: 88.606 N N N N
vg0314533381 A -> G LOC_Os03g25410-LOC_Os03g25420 intergenic_region ; MODIFIER silent_mutation Average:76.896; most accessible tissue: Zhenshan97 flag leaf, score: 88.606 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0314533381 A G -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314533381 NA 4.16E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 2.75E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 6.03E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 3.03E-08 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 1.59E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 6.39E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 1.66E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 4.01E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 5.60E-06 3.63E-06 mr1492 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 6.86E-06 6.86E-06 mr1506 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 7.64E-06 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 5.17E-07 NA mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 1.00E-06 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 2.83E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 4.67E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 8.94E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 2.61E-09 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 1.98E-08 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 2.59E-08 NA mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533381 NA 1.09E-11 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251