\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314512032:

Variant ID: vg0314512032 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 14512032
Reference Allele: CTCGAGGAGATAlternative Allele: ATCGAGGAGAT,C
Primary Allele: CTCGAGGAGATSecondary Allele: ATCGAGGAGAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAATCTGGATAGTCCATGTTATGCTGCTGCTCCATGTCCGTGAGATGATCGGGGCCCATGTTGTGGATATAGTACTATGTGAGATGATCGGGGCGTTG[CTCGAGGAGAT/ATCGAGGAGAT,C]
TGATGAAGATGGGTAGCAACGGTGGCAGGCCGGCGATCTTGTGGCGGAGGAAGTGAAGGACGAGGTCATCGTCCGTGGGCTGGAAGTGGAAAGCCAGGGG

Reverse complement sequence

CCCCTGGCTTTCCACTTCCAGCCCACGGACGATGACCTCGTCCTTCACTTCCTCCGCCACAAGATCGCCGGCCTGCCACCGTTGCTACCCATCTTCATCA[ATCTCCTCGAG/ATCTCCTCGAT,G]
CAACGCCCCGATCATCTCACATAGTACTATATCCACAACATGGGCCCCGATCATCTCACGGACATGGAGCAGCAGCATAACATGGACTATCCAGATTTCT

Allele Frequencies:

Populations Population SizeFrequency of CTCGAGGAGAT(primary allele) Frequency of ATCGAGGAGAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.40% 15.50% 0.85% 0.13% C: 0.13%
All Indica  2759 75.40% 23.20% 1.27% 0.18% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 68.00% 27.90% 1.86% 0.00% C: 2.23%
Indica I  595 52.80% 44.00% 2.86% 0.34% NA
Indica II  465 58.70% 40.40% 0.86% 0.00% NA
Indica III  913 93.50% 6.20% 0.22% 0.00% NA
Indica Intermediate  786 81.30% 16.80% 1.53% 0.38% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314512032 CTCGAGGAGAT -> C LOC_Os03g25374.1 upstream_gene_variant ; 3471.0bp to feature; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> C LOC_Os03g25380.1 upstream_gene_variant ; 447.0bp to feature; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> C LOC_Os03g25390.2 downstream_gene_variant ; 1663.0bp to feature; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> C LOC_Os03g25390.1 downstream_gene_variant ; 1663.0bp to feature; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> C LOC_Os03g25390.3 downstream_gene_variant ; 1663.0bp to feature; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> C LOC_Os03g25374-LOC_Os03g25380 intergenic_region ; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> DEL N N silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> ATCGAGGAGAT LOC_Os03g25374.1 upstream_gene_variant ; 3470.0bp to feature; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> ATCGAGGAGAT LOC_Os03g25380.1 upstream_gene_variant ; 448.0bp to feature; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> ATCGAGGAGAT LOC_Os03g25390.2 downstream_gene_variant ; 1664.0bp to feature; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> ATCGAGGAGAT LOC_Os03g25390.1 downstream_gene_variant ; 1664.0bp to feature; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> ATCGAGGAGAT LOC_Os03g25390.3 downstream_gene_variant ; 1664.0bp to feature; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N
vg0314512032 CTCGAGGAGAT -> ATCGAGGAGAT LOC_Os03g25374-LOC_Os03g25380 intergenic_region ; MODIFIER silent_mutation Average:85.495; most accessible tissue: Callus, score: 92.833 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0314512032 CTCGA* ATCGA* -0.01 -0.01 -0.01 -0.01 -0.01 -0.01
vg0314512032 CTCGA* C -0.12 -0.07 0.06 -0.04 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314512032 4.75E-21 2.87E-40 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314512032 1.16E-16 8.58E-19 mr1542 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314512032 7.18E-24 1.33E-47 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314512032 3.05E-21 1.01E-22 mr1542_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314512032 5.67E-12 1.32E-17 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314512032 4.39E-09 1.11E-09 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251