Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0314508666:

Variant ID: vg0314508666 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14508666
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGCGCTGTGTTCCACTCCCTCCATCCTACAACGTCGTTACTTGTTCCAGCGACCAGTGTCGAACTTGCTCGCTCGATGCCCATGGTCCATGGAGTAGG[G/A]
AGAGCAGGTAGTGCTTGTGCCGCATGCACACGCTGCCACGCATCCATGTATGTATGCATGGATGGATGGAATTATGTTGCTTGATACTATGAATGTGAGT

Reverse complement sequence

ACTCACATTCATAGTATCAAGCAACATAATTCCATCCATCCATGCATACATACATGGATGCGTGGCAGCGTGTGCATGCGGCACAAGCACTACCTGCTCT[C/T]
CCTACTCCATGGACCATGGGCATCGAGCGAGCAAGTTCGACACTGGTCGCTGGAACAAGTAACGACGTTGTAGGATGGAGGGAGTGGAACACAGCGCCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	28.90%	2.41%	0.00%	NA
All Indica	2759	93.60%	6.20%	0.14%	0.00%	NA
All Japonica	1512	29.20%	63.80%	7.01%	0.00%	NA
Aus	269	58.40%	41.30%	0.37%	0.00%	NA
Indica I	595	96.50%	3.40%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	89.50%	10.30%	0.22%	0.00%	NA
Indica Intermediate	786	92.50%	7.40%	0.13%	0.00%	NA
Temperate Japonica	767	53.50%	33.90%	12.65%	0.00%	NA
Tropical Japonica	504	2.40%	97.20%	0.40%	0.00%	NA
Japonica Intermediate	241	8.30%	88.80%	2.90%	0.00%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	54.40%	42.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314508666	G -> A	LOC_Os03g25374.1	upstream_gene_variant ; 104.0bp to feature; MODIFIER	silent_mutation	Average:66.181; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0314508666	G -> A	LOC_Os03g25380.1	upstream_gene_variant ; 3814.0bp to feature; MODIFIER	silent_mutation	Average:66.181; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0314508666	G -> A	LOC_Os03g25370.1	downstream_gene_variant ; 2693.0bp to feature; MODIFIER	silent_mutation	Average:66.181; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0314508666	G -> A	LOC_Os03g25374-LOC_Os03g25380	intergenic_region ; MODIFIER	silent_mutation	Average:66.181; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314508666	NA	1.09E-07	mr1446_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314508666	NA	3.66E-10	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314508666	NA	1.01E-13	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314508666	4.03E-06	NA	mr1540_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314508666	6.00E-06	NA	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251