\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314508666:

Variant ID: vg0314508666 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14508666
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGCGCTGTGTTCCACTCCCTCCATCCTACAACGTCGTTACTTGTTCCAGCGACCAGTGTCGAACTTGCTCGCTCGATGCCCATGGTCCATGGAGTAGG[G/A]
AGAGCAGGTAGTGCTTGTGCCGCATGCACACGCTGCCACGCATCCATGTATGTATGCATGGATGGATGGAATTATGTTGCTTGATACTATGAATGTGAGT

Reverse complement sequence

ACTCACATTCATAGTATCAAGCAACATAATTCCATCCATCCATGCATACATACATGGATGCGTGGCAGCGTGTGCATGCGGCACAAGCACTACCTGCTCT[C/T]
CCTACTCCATGGACCATGGGCATCGAGCGAGCAAGTTCGACACTGGTCGCTGGAACAAGTAACGACGTTGTAGGATGGAGGGAGTGGAACACAGCGCCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 28.90% 2.41% 0.00% NA
All Indica  2759 93.60% 6.20% 0.14% 0.00% NA
All Japonica  1512 29.20% 63.80% 7.01% 0.00% NA
Aus  269 58.40% 41.30% 0.37% 0.00% NA
Indica I  595 96.50% 3.40% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 89.50% 10.30% 0.22% 0.00% NA
Indica Intermediate  786 92.50% 7.40% 0.13% 0.00% NA
Temperate Japonica  767 53.50% 33.90% 12.65% 0.00% NA
Tropical Japonica  504 2.40% 97.20% 0.40% 0.00% NA
Japonica Intermediate  241 8.30% 88.80% 2.90% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 54.40% 42.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314508666 G -> A LOC_Os03g25374.1 upstream_gene_variant ; 104.0bp to feature; MODIFIER silent_mutation Average:66.181; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0314508666 G -> A LOC_Os03g25380.1 upstream_gene_variant ; 3814.0bp to feature; MODIFIER silent_mutation Average:66.181; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0314508666 G -> A LOC_Os03g25370.1 downstream_gene_variant ; 2693.0bp to feature; MODIFIER silent_mutation Average:66.181; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0314508666 G -> A LOC_Os03g25374-LOC_Os03g25380 intergenic_region ; MODIFIER silent_mutation Average:66.181; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314508666 NA 1.09E-07 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314508666 NA 3.66E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314508666 NA 1.01E-13 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314508666 4.03E-06 NA mr1540_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314508666 6.00E-06 NA mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251