\
| Variant ID: vg0314498825 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14498825 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )
TCCCTTCACCGGAGATCGAAAGCCGACGCAGCCCCGCGTCAGGTGCCAAATTCTGCCGGATGATAAATAAAAACCTCAGTAAAGAGGGTGGCGATGCACC[G/A]
AGAGTAGTTGTATTGATCGATATATTGATAGATTACAATGACCCCGGGTGTACATATTTATACCCATAGGGAGATACTAGTCCTTATCGGACAAGAAAGA
TCTTTCTTGTCCGATAAGGACTAGTATCTCCCTATGGGTATAAATATGTACACCCGGGGTCATTGTAATCTATCAATATATCGATCAATACAACTACTCT[C/T]
GGTGCATCGCCACCCTCTTTACTGAGGTTTTTATTTATCATCCGGCAGAATTTGGCACCTGACGCGGGGCTGCGTCGGCTTTCGATCTCCGGTGAAGGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.50% | 24.30% | 2.35% | 2.88% | NA |
| All Indica | 2759 | 50.60% | 40.70% | 3.88% | 4.75% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.07% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.74% | 0.37% | NA |
| Indica I | 595 | 56.10% | 37.30% | 6.39% | 0.17% | NA |
| Indica II | 465 | 58.50% | 24.70% | 5.38% | 11.40% | NA |
| Indica III | 913 | 44.60% | 52.50% | 1.20% | 1.75% | NA |
| Indica Intermediate | 786 | 48.90% | 39.20% | 4.20% | 7.76% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 80.00% | 16.70% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314498825 | G -> A | LOC_Os03g25364.1 | upstream_gene_variant ; 2492.0bp to feature; MODIFIER | silent_mutation | Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0314498825 | G -> A | LOC_Os03g25360.1 | downstream_gene_variant ; 2462.0bp to feature; MODIFIER | silent_mutation | Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0314498825 | G -> A | LOC_Os03g25360-LOC_Os03g25364 | intergenic_region ; MODIFIER | silent_mutation | Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0314498825 | G -> DEL | N | N | silent_mutation | Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314498825 | 4.64E-22 | NA | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314498825 | 2.86E-19 | 1.87E-28 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314498825 | NA | 1.50E-06 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314498825 | 2.20E-27 | NA | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314498825 | 2.77E-28 | 1.75E-35 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314498825 | 4.36E-11 | NA | mr1587_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314498825 | 3.59E-10 | 5.81E-15 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |