\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314498825:

Variant ID: vg0314498825 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14498825
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCTTCACCGGAGATCGAAAGCCGACGCAGCCCCGCGTCAGGTGCCAAATTCTGCCGGATGATAAATAAAAACCTCAGTAAAGAGGGTGGCGATGCACC[G/A]
AGAGTAGTTGTATTGATCGATATATTGATAGATTACAATGACCCCGGGTGTACATATTTATACCCATAGGGAGATACTAGTCCTTATCGGACAAGAAAGA

Reverse complement sequence

TCTTTCTTGTCCGATAAGGACTAGTATCTCCCTATGGGTATAAATATGTACACCCGGGGTCATTGTAATCTATCAATATATCGATCAATACAACTACTCT[C/T]
GGTGCATCGCCACCCTCTTTACTGAGGTTTTTATTTATCATCCGGCAGAATTTGGCACCTGACGCGGGGCTGCGTCGGCTTTCGATCTCCGGTGAAGGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 24.30% 2.35% 2.88% NA
All Indica  2759 50.60% 40.70% 3.88% 4.75% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.07% NA
Aus  269 98.90% 0.00% 0.74% 0.37% NA
Indica I  595 56.10% 37.30% 6.39% 0.17% NA
Indica II  465 58.50% 24.70% 5.38% 11.40% NA
Indica III  913 44.60% 52.50% 1.20% 1.75% NA
Indica Intermediate  786 48.90% 39.20% 4.20% 7.76% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 0.00% 1.04% NA
Intermediate  90 80.00% 16.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314498825 G -> A LOC_Os03g25364.1 upstream_gene_variant ; 2492.0bp to feature; MODIFIER silent_mutation Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0314498825 G -> A LOC_Os03g25360.1 downstream_gene_variant ; 2462.0bp to feature; MODIFIER silent_mutation Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0314498825 G -> A LOC_Os03g25360-LOC_Os03g25364 intergenic_region ; MODIFIER silent_mutation Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0314498825 G -> DEL N N silent_mutation Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314498825 4.64E-22 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825 2.86E-19 1.87E-28 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825 NA 1.50E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825 2.20E-27 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825 2.77E-28 1.75E-35 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825 4.36E-11 NA mr1587_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825 3.59E-10 5.81E-15 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251