\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314430615:

Variant ID: vg0314430615 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14430615
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGGTAGAAACAACCTCTTCATATATAGTCCCTAATATAACATTACTCCATAAAAATAAGGACGTAACGCATAACTAGATACCGGTAGAAACTGTCTCTT[C/T]
ATATATAGTCCCTAATAGGATGTTACTCCATAAAAATAAGGATGAAATGCATACTTGGATACCGATAGAAACAATTGCTTTATATATATAGTCGCTAATA

Reverse complement sequence

TATTAGCGACTATATATATAAAGCAATTGTTTCTATCGGTATCCAAGTATGCATTTCATCCTTATTTTTATGGAGTAACATCCTATTAGGGACTATATAT[G/A]
AAGAGACAGTTTCTACCGGTATCTAGTTATGCGTTACGTCCTTATTTTTATGGAGTAATGTTATATTAGGGACTATATATGAAGAGGTTGTTTCTACCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 4.70% 4.93% 32.12% NA
All Indica  2759 75.30% 6.50% 6.74% 11.49% NA
All Japonica  1512 34.50% 0.10% 0.40% 65.08% NA
Aus  269 36.40% 13.40% 13.01% 37.17% NA
Indica I  595 55.80% 9.40% 8.24% 26.55% NA
Indica II  465 59.10% 14.80% 8.60% 17.42% NA
Indica III  913 91.70% 1.00% 5.48% 1.86% NA
Indica Intermediate  786 80.50% 5.70% 5.98% 7.76% NA
Temperate Japonica  767 61.80% 0.00% 0.52% 37.68% NA
Tropical Japonica  504 4.00% 0.00% 0.00% 96.03% NA
Japonica Intermediate  241 11.20% 0.40% 0.83% 87.55% NA
VI/Aromatic  96 17.70% 0.00% 2.08% 80.21% NA
Intermediate  90 43.30% 7.80% 4.44% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314430615 C -> T LOC_Os03g25270.1 upstream_gene_variant ; 1156.0bp to feature; MODIFIER silent_mutation Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0314430615 C -> T LOC_Os03g25270.2 upstream_gene_variant ; 1014.0bp to feature; MODIFIER silent_mutation Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0314430615 C -> T LOC_Os03g25270.3 upstream_gene_variant ; 1251.0bp to feature; MODIFIER silent_mutation Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0314430615 C -> T LOC_Os03g25270.4 upstream_gene_variant ; 1257.0bp to feature; MODIFIER silent_mutation Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0314430615 C -> T LOC_Os03g25260.1 downstream_gene_variant ; 2746.0bp to feature; MODIFIER silent_mutation Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0314430615 C -> T LOC_Os03g25260-LOC_Os03g25270 intergenic_region ; MODIFIER silent_mutation Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0314430615 C -> DEL N N silent_mutation Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314430615 5.85E-07 5.83E-07 mr1250 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314430615 3.05E-07 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314430615 NA 1.29E-09 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314430615 6.15E-07 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314430615 NA 7.51E-12 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251