\
| Variant ID: vg0314430615 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14430615 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGGTAGAAACAACCTCTTCATATATAGTCCCTAATATAACATTACTCCATAAAAATAAGGACGTAACGCATAACTAGATACCGGTAGAAACTGTCTCTT[C/T]
ATATATAGTCCCTAATAGGATGTTACTCCATAAAAATAAGGATGAAATGCATACTTGGATACCGATAGAAACAATTGCTTTATATATATAGTCGCTAATA
TATTAGCGACTATATATATAAAGCAATTGTTTCTATCGGTATCCAAGTATGCATTTCATCCTTATTTTTATGGAGTAACATCCTATTAGGGACTATATAT[G/A]
AAGAGACAGTTTCTACCGGTATCTAGTTATGCGTTACGTCCTTATTTTTATGGAGTAATGTTATATTAGGGACTATATATGAAGAGGTTGTTTCTACCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.20% | 4.70% | 4.93% | 32.12% | NA |
| All Indica | 2759 | 75.30% | 6.50% | 6.74% | 11.49% | NA |
| All Japonica | 1512 | 34.50% | 0.10% | 0.40% | 65.08% | NA |
| Aus | 269 | 36.40% | 13.40% | 13.01% | 37.17% | NA |
| Indica I | 595 | 55.80% | 9.40% | 8.24% | 26.55% | NA |
| Indica II | 465 | 59.10% | 14.80% | 8.60% | 17.42% | NA |
| Indica III | 913 | 91.70% | 1.00% | 5.48% | 1.86% | NA |
| Indica Intermediate | 786 | 80.50% | 5.70% | 5.98% | 7.76% | NA |
| Temperate Japonica | 767 | 61.80% | 0.00% | 0.52% | 37.68% | NA |
| Tropical Japonica | 504 | 4.00% | 0.00% | 0.00% | 96.03% | NA |
| Japonica Intermediate | 241 | 11.20% | 0.40% | 0.83% | 87.55% | NA |
| VI/Aromatic | 96 | 17.70% | 0.00% | 2.08% | 80.21% | NA |
| Intermediate | 90 | 43.30% | 7.80% | 4.44% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314430615 | C -> T | LOC_Os03g25270.1 | upstream_gene_variant ; 1156.0bp to feature; MODIFIER | silent_mutation | Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0314430615 | C -> T | LOC_Os03g25270.2 | upstream_gene_variant ; 1014.0bp to feature; MODIFIER | silent_mutation | Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0314430615 | C -> T | LOC_Os03g25270.3 | upstream_gene_variant ; 1251.0bp to feature; MODIFIER | silent_mutation | Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0314430615 | C -> T | LOC_Os03g25270.4 | upstream_gene_variant ; 1257.0bp to feature; MODIFIER | silent_mutation | Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0314430615 | C -> T | LOC_Os03g25260.1 | downstream_gene_variant ; 2746.0bp to feature; MODIFIER | silent_mutation | Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0314430615 | C -> T | LOC_Os03g25260-LOC_Os03g25270 | intergenic_region ; MODIFIER | silent_mutation | Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0314430615 | C -> DEL | N | N | silent_mutation | Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314430615 | 5.85E-07 | 5.83E-07 | mr1250 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314430615 | 3.05E-07 | NA | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314430615 | NA | 1.29E-09 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314430615 | 6.15E-07 | NA | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314430615 | NA | 7.51E-12 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |