\
| Variant ID: vg0314425542 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14425542 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.17, others allele: 0.00, population size: 94. )
GCTTGATTATTGCTCCAATGTTAAGGGCCACACATTGCAGGTTTTGTTTGTGTTAAAATAGAGCAATTGAAAGGATTGGGCCATCTTGACCGGTAGTTTT[A/G]
GTAAATGACCTCTGCAGATGTTTGCATGAAGAGTTTTGTGTAGAATTTCTACTGCTCATATATGTGGCGAATATGCTCTGCCTTAATTATACCAGCACTA
TAGTGCTGGTATAATTAAGGCAGAGCATATTCGCCACATATATGAGCAGTAGAAATTCTACACAAAACTCTTCATGCAAACATCTGCAGAGGTCATTTAC[T/C]
AAAACTACCGGTCAAGATGGCCCAATCCTTTCAATTGCTCTATTTTAACACAAACAAAACCTGCAATGTGTGGCCCTTAACATTGGAGCAATAATCAAGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.30% | 39.60% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 80.10% | 19.80% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 33.40% | 66.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 30.50% | 69.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 81.00% | 18.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.50% | 26.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 77.00% | 22.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 60.90% | 39.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.80% | 89.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314425542 | A -> G | LOC_Os03g25250.1 | upstream_gene_variant ; 1211.0bp to feature; MODIFIER | silent_mutation | Average:45.183; most accessible tissue: Callus, score: 81.119 | N | N | N | N |
| vg0314425542 | A -> G | LOC_Os03g25260.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.183; most accessible tissue: Callus, score: 81.119 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314425542 | NA | 7.40E-21 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314425542 | NA | 1.74E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314425542 | NA | 1.97E-09 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 9.73E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 3.90E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 2.95E-11 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 2.88E-08 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 9.18E-06 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 6.01E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 3.79E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | 1.56E-06 | 1.43E-12 | mr1798 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 4.51E-06 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 7.73E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 7.82E-09 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 1.83E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 6.36E-12 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 8.42E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 3.39E-08 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 4.36E-15 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314425542 | NA | 2.09E-07 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |