\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314415225:

Variant ID: vg0314415225 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14415225
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGAACAGGAATAGTGCGTACGAAAAATAGAGCAGTTCATTAGCGTGTGATTAATTAAGTATTAGTAAATTATTTTTAAAAAATAGATCGATATGATTT[T/G]
TATAAGCAACTTTCATATAAAAACTTTTTACAAAAAACGCACCGTTTAGCAGTTTGAAAAACGTACAAGCGGAAAACAAGTTGGGAGTGTTGGGAAAAGA

Reverse complement sequence

TCTTTTCCCAACACTCCCAACTTGTTTTCCGCTTGTACGTTTTTCAAACTGCTAAACGGTGCGTTTTTTGTAAAAAGTTTTTATATGAAAGTTGCTTATA[A/C]
AAATCATATCGATCTATTTTTTAAAAATAATTTACTAATACTTAATTAATCACACGCTAATGAACTGCTCTATTTTTCGTACGCACTATTCCTGTTCGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.80% 34.20% 0.57% 24.42% NA
All Indica  2759 64.50% 34.20% 0.18% 1.16% NA
All Japonica  1512 0.90% 36.90% 0.20% 61.97% NA
Aus  269 35.70% 30.90% 5.20% 28.25% NA
Indica I  595 48.20% 51.60% 0.17% 0.00% NA
Indica II  465 56.10% 43.90% 0.00% 0.00% NA
Indica III  913 74.00% 24.50% 0.22% 1.20% NA
Indica Intermediate  786 70.60% 26.50% 0.25% 2.67% NA
Temperate Japonica  767 0.30% 65.20% 0.13% 34.42% NA
Tropical Japonica  504 1.40% 4.80% 0.20% 93.65% NA
Japonica Intermediate  241 2.10% 14.10% 0.41% 83.40% NA
VI/Aromatic  96 13.50% 3.10% 1.04% 82.29% NA
Intermediate  90 28.90% 33.30% 4.44% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314415225 T -> DEL N N silent_mutation Average:60.956; most accessible tissue: Callus, score: 86.913 N N N N
vg0314415225 T -> G LOC_Os03g25210.1 upstream_gene_variant ; 3140.0bp to feature; MODIFIER silent_mutation Average:60.956; most accessible tissue: Callus, score: 86.913 N N N N
vg0314415225 T -> G LOC_Os03g25220.1 upstream_gene_variant ; 317.0bp to feature; MODIFIER silent_mutation Average:60.956; most accessible tissue: Callus, score: 86.913 N N N N
vg0314415225 T -> G LOC_Os03g25240.1 upstream_gene_variant ; 3798.0bp to feature; MODIFIER silent_mutation Average:60.956; most accessible tissue: Callus, score: 86.913 N N N N
vg0314415225 T -> G LOC_Os03g25220-LOC_Os03g25240 intergenic_region ; MODIFIER silent_mutation Average:60.956; most accessible tissue: Callus, score: 86.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314415225 2.96E-06 5.41E-09 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314415225 1.34E-08 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314415225 6.04E-07 1.66E-11 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314415225 3.24E-07 NA mr1587_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251