Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0314415225:

Variant ID: vg0314415225 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14415225
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TCCGAACAGGAATAGTGCGTACGAAAAATAGAGCAGTTCATTAGCGTGTGATTAATTAAGTATTAGTAAATTATTTTTAAAAAATAGATCGATATGATTT[T/G]
TATAAGCAACTTTCATATAAAAACTTTTTACAAAAAACGCACCGTTTAGCAGTTTGAAAAACGTACAAGCGGAAAACAAGTTGGGAGTGTTGGGAAAAGA

Reverse complement sequence

TCTTTTCCCAACACTCCCAACTTGTTTTCCGCTTGTACGTTTTTCAAACTGCTAAACGGTGCGTTTTTTGTAAAAAGTTTTTATATGAAAGTTGCTTATA[A/C]
AAATCATATCGATCTATTTTTTAAAAATAATTTACTAATACTTAATTAATCACACGCTAATGAACTGCTCTATTTTTCGTACGCACTATTCCTGTTCGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.80%	34.20%	0.57%	24.42%	NA
All Indica	2759	64.50%	34.20%	0.18%	1.16%	NA
All Japonica	1512	0.90%	36.90%	0.20%	61.97%	NA
Aus	269	35.70%	30.90%	5.20%	28.25%	NA
Indica I	595	48.20%	51.60%	0.17%	0.00%	NA
Indica II	465	56.10%	43.90%	0.00%	0.00%	NA
Indica III	913	74.00%	24.50%	0.22%	1.20%	NA
Indica Intermediate	786	70.60%	26.50%	0.25%	2.67%	NA
Temperate Japonica	767	0.30%	65.20%	0.13%	34.42%	NA
Tropical Japonica	504	1.40%	4.80%	0.20%	93.65%	NA
Japonica Intermediate	241	2.10%	14.10%	0.41%	83.40%	NA
VI/Aromatic	96	13.50%	3.10%	1.04%	82.29%	NA
Intermediate	90	28.90%	33.30%	4.44%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314415225	T -> DEL	N	N	silent_mutation	Average:60.956; most accessible tissue: Callus, score: 86.913	N	N	N	N
vg0314415225	T -> G	LOC_Os03g25210.1	upstream_gene_variant ; 3140.0bp to feature; MODIFIER	silent_mutation	Average:60.956; most accessible tissue: Callus, score: 86.913	N	N	N	N
vg0314415225	T -> G	LOC_Os03g25220.1	upstream_gene_variant ; 317.0bp to feature; MODIFIER	silent_mutation	Average:60.956; most accessible tissue: Callus, score: 86.913	N	N	N	N
vg0314415225	T -> G	LOC_Os03g25240.1	upstream_gene_variant ; 3798.0bp to feature; MODIFIER	silent_mutation	Average:60.956; most accessible tissue: Callus, score: 86.913	N	N	N	N
vg0314415225	T -> G	LOC_Os03g25220-LOC_Os03g25240	intergenic_region ; MODIFIER	silent_mutation	Average:60.956; most accessible tissue: Callus, score: 86.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314415225	2.96E-06	5.41E-09	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314415225	1.34E-08	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314415225	6.04E-07	1.66E-11	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314415225	3.24E-07	NA	mr1587_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251