\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313204857:

Variant ID: vg0313204857 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13204857
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGACATCGTCGGAAGACACCCACCCCCTCGGTAAGTTCTCCTGTTCTTTCATCACGTAGTCAGAAAACTTCCACCTCACATCATATCCGTTATACTCCA[G/A]
GCCTCGGACGCGTCTCCCCCGCCTCCACGTCGGCAACGGCTAGTGACGCTTGGCGAGAAGCAAGTGGATGACTTTGAGGTTTTGTCACTTCGTCAAACTG

Reverse complement sequence

CAGTTTGACGAAGTGACAAAACCTCAAAGTCATCCACTTGCTTCTCGCCAAGCGTCACTAGCCGTTGCCGACGTGGAGGCGGGGGAGACGCGTCCGAGGC[C/T]
TGGAGTATAACGGATATGATGTGAGGTGGAAGTTTTCTGACTACGTGATGAAAGAACAGGAGAACTTACCGAGGGGGTGGGTGTCTTCCGACGATGTCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 11.40% 0.97% 1.14% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 64.40% 29.80% 2.31% 3.44% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 96.90% 3.00% 0.00% 0.13% NA
Tropical Japonica  504 21.60% 64.10% 4.76% 9.52% NA
Japonica Intermediate  241 50.60% 43.60% 4.56% 1.24% NA
VI/Aromatic  96 19.80% 74.00% 5.21% 1.04% NA
Intermediate  90 76.70% 16.70% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313204857 G -> A LOC_Os03g22830.1 upstream_gene_variant ; 3547.0bp to feature; MODIFIER silent_mutation Average:62.281; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0313204857 G -> A LOC_Os03g22830.2 upstream_gene_variant ; 3550.0bp to feature; MODIFIER silent_mutation Average:62.281; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0313204857 G -> A LOC_Os03g22850.1 downstream_gene_variant ; 2895.0bp to feature; MODIFIER silent_mutation Average:62.281; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0313204857 G -> A LOC_Os03g22840.1 intron_variant ; MODIFIER silent_mutation Average:62.281; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0313204857 G -> DEL N N silent_mutation Average:62.281; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313204857 NA 1.65E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 2.40E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 9.12E-14 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 8.23E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 6.23E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 3.06E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 7.83E-10 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 1.42E-06 NA mr1125_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 1.82E-10 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 2.14E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 2.71E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 8.91E-11 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 1.22E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 3.14E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 6.60E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 1.17E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 1.63E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 9.76E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 5.46E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313204857 NA 1.79E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251