\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312626517:

Variant ID: vg0312626517 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 12626517
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAAGAGGGCCTTAGTTTTCTTAGCTTCTTCCATACATCCTAAAATAAATTTATTTTAAAAGTAATCGTTACATGAAAGTTAAGTTTGTAAAAATAAAGG[C/G]
TAATTATATTGGAAATAGATAAAATGATAAATAATTATATTAGGATTTGATAAAGTAAGATCTTGTTCGATTAATCTCCAAGAAACGAGGAATGGAGAAG

Reverse complement sequence

CTTCTCCATTCCTCGTTTCTTGGAGATTAATCGAACAAGATCTTACTTTATCAAATCCTAATATAATTATTTATCATTTTATCTATTTCCAATATAATTA[G/C]
CCTTTATTTTTACAAACTTAACTTTCATGTAACGATTACTTTTAAAATAAATTTATTTTAGGATGTATGGAAGAAGCTAAGAAAACTAAGGCCCTCTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 5.30% 1.18% 0.00% NA
All Indica  2759 99.00% 0.90% 0.07% 0.00% NA
All Japonica  1512 82.30% 14.50% 3.17% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 97.80% 0.40% 1.83% 0.00% NA
Tropical Japonica  504 56.00% 38.90% 5.16% 0.00% NA
Japonica Intermediate  241 88.40% 8.30% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 6.70% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0312626517 C -> G LOC_Os03g22030.1 upstream_gene_variant ; 658.0bp to feature; MODIFIER silent_mutation Average:44.954; most accessible tissue: Callus, score: 76.686 N N N N
vg0312626517 C -> G LOC_Os03g22040.1 upstream_gene_variant ; 773.0bp to feature; MODIFIER silent_mutation Average:44.954; most accessible tissue: Callus, score: 76.686 N N N N
vg0312626517 C -> G LOC_Os03g22050.1 downstream_gene_variant ; 4188.0bp to feature; MODIFIER silent_mutation Average:44.954; most accessible tissue: Callus, score: 76.686 N N N N
vg0312626517 C -> G LOC_Os03g22050.3 downstream_gene_variant ; 4188.0bp to feature; MODIFIER silent_mutation Average:44.954; most accessible tissue: Callus, score: 76.686 N N N N
vg0312626517 C -> G LOC_Os03g22050.4 downstream_gene_variant ; 4188.0bp to feature; MODIFIER silent_mutation Average:44.954; most accessible tissue: Callus, score: 76.686 N N N N
vg0312626517 C -> G LOC_Os03g22050.2 downstream_gene_variant ; 4188.0bp to feature; MODIFIER silent_mutation Average:44.954; most accessible tissue: Callus, score: 76.686 N N N N
vg0312626517 C -> G LOC_Os03g22030-LOC_Os03g22040 intergenic_region ; MODIFIER silent_mutation Average:44.954; most accessible tissue: Callus, score: 76.686 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0312626517 NA 2.60E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517 NA 3.95E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517 NA 9.21E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517 NA 3.69E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517 NA 6.97E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517 NA 4.61E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517 NA 6.43E-10 mr1830 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517 NA 7.01E-10 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251