| Variant ID: vg0312626517 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 12626517 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CAAAGAGGGCCTTAGTTTTCTTAGCTTCTTCCATACATCCTAAAATAAATTTATTTTAAAAGTAATCGTTACATGAAAGTTAAGTTTGTAAAAATAAAGG[C/G]
TAATTATATTGGAAATAGATAAAATGATAAATAATTATATTAGGATTTGATAAAGTAAGATCTTGTTCGATTAATCTCCAAGAAACGAGGAATGGAGAAG
CTTCTCCATTCCTCGTTTCTTGGAGATTAATCGAACAAGATCTTACTTTATCAAATCCTAATATAATTATTTATCATTTTATCTATTTCCAATATAATTA[G/C]
CCTTTATTTTTACAAACTTAACTTTCATGTAACGATTACTTTTAAAATAAATTTATTTTAGGATGTATGGAAGAAGCTAAGAAAACTAAGGCCCTCTTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 5.30% | 1.18% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 0.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 82.30% | 14.50% | 3.17% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 0.40% | 1.83% | 0.00% | NA |
| Tropical Japonica | 504 | 56.00% | 38.90% | 5.16% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 8.30% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 6.70% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0312626517 | C -> G | LOC_Os03g22030.1 | upstream_gene_variant ; 658.0bp to feature; MODIFIER | silent_mutation | Average:44.954; most accessible tissue: Callus, score: 76.686 | N | N | N | N |
| vg0312626517 | C -> G | LOC_Os03g22040.1 | upstream_gene_variant ; 773.0bp to feature; MODIFIER | silent_mutation | Average:44.954; most accessible tissue: Callus, score: 76.686 | N | N | N | N |
| vg0312626517 | C -> G | LOC_Os03g22050.1 | downstream_gene_variant ; 4188.0bp to feature; MODIFIER | silent_mutation | Average:44.954; most accessible tissue: Callus, score: 76.686 | N | N | N | N |
| vg0312626517 | C -> G | LOC_Os03g22050.3 | downstream_gene_variant ; 4188.0bp to feature; MODIFIER | silent_mutation | Average:44.954; most accessible tissue: Callus, score: 76.686 | N | N | N | N |
| vg0312626517 | C -> G | LOC_Os03g22050.4 | downstream_gene_variant ; 4188.0bp to feature; MODIFIER | silent_mutation | Average:44.954; most accessible tissue: Callus, score: 76.686 | N | N | N | N |
| vg0312626517 | C -> G | LOC_Os03g22050.2 | downstream_gene_variant ; 4188.0bp to feature; MODIFIER | silent_mutation | Average:44.954; most accessible tissue: Callus, score: 76.686 | N | N | N | N |
| vg0312626517 | C -> G | LOC_Os03g22030-LOC_Os03g22040 | intergenic_region ; MODIFIER | silent_mutation | Average:44.954; most accessible tissue: Callus, score: 76.686 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0312626517 | NA | 2.60E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312626517 | NA | 3.95E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312626517 | NA | 9.21E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312626517 | NA | 3.69E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312626517 | NA | 6.97E-08 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312626517 | NA | 4.61E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312626517 | NA | 6.43E-10 | mr1830 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312626517 | NA | 7.01E-10 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |