Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0312626517:

Variant ID: vg0312626517 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 12626517
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAAGAGGGCCTTAGTTTTCTTAGCTTCTTCCATACATCCTAAAATAAATTTATTTTAAAAGTAATCGTTACATGAAAGTTAAGTTTGTAAAAATAAAGG[C/G]
TAATTATATTGGAAATAGATAAAATGATAAATAATTATATTAGGATTTGATAAAGTAAGATCTTGTTCGATTAATCTCCAAGAAACGAGGAATGGAGAAG

Reverse complement sequence

CTTCTCCATTCCTCGTTTCTTGGAGATTAATCGAACAAGATCTTACTTTATCAAATCCTAATATAATTATTTATCATTTTATCTATTTCCAATATAATTA[G/C]
CCTTTATTTTTACAAACTTAACTTTCATGTAACGATTACTTTTAAAATAAATTTATTTTAGGATGTATGGAAGAAGCTAAGAAAACTAAGGCCCTCTTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	5.30%	1.18%	0.00%	NA
All Indica	2759	99.00%	0.90%	0.07%	0.00%	NA
All Japonica	1512	82.30%	14.50%	3.17%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	97.70%	2.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	97.80%	0.40%	1.83%	0.00%	NA
Tropical Japonica	504	56.00%	38.90%	5.16%	0.00%	NA
Japonica Intermediate	241	88.40%	8.30%	3.32%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	6.70%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0312626517	C -> G	LOC_Os03g22030.1	upstream_gene_variant ; 658.0bp to feature; MODIFIER	silent_mutation	Average:44.954; most accessible tissue: Callus, score: 76.686	N	N	N	N
vg0312626517	C -> G	LOC_Os03g22040.1	upstream_gene_variant ; 773.0bp to feature; MODIFIER	silent_mutation	Average:44.954; most accessible tissue: Callus, score: 76.686	N	N	N	N
vg0312626517	C -> G	LOC_Os03g22050.1	downstream_gene_variant ; 4188.0bp to feature; MODIFIER	silent_mutation	Average:44.954; most accessible tissue: Callus, score: 76.686	N	N	N	N
vg0312626517	C -> G	LOC_Os03g22050.3	downstream_gene_variant ; 4188.0bp to feature; MODIFIER	silent_mutation	Average:44.954; most accessible tissue: Callus, score: 76.686	N	N	N	N
vg0312626517	C -> G	LOC_Os03g22050.4	downstream_gene_variant ; 4188.0bp to feature; MODIFIER	silent_mutation	Average:44.954; most accessible tissue: Callus, score: 76.686	N	N	N	N
vg0312626517	C -> G	LOC_Os03g22050.2	downstream_gene_variant ; 4188.0bp to feature; MODIFIER	silent_mutation	Average:44.954; most accessible tissue: Callus, score: 76.686	N	N	N	N
vg0312626517	C -> G	LOC_Os03g22030-LOC_Os03g22040	intergenic_region ; MODIFIER	silent_mutation	Average:44.954; most accessible tissue: Callus, score: 76.686	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0312626517	NA	2.60E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517	NA	3.95E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517	NA	9.21E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517	NA	3.69E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517	NA	6.97E-08	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517	NA	4.61E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517	NA	6.43E-10	mr1830	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312626517	NA	7.01E-10	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251