\
| Variant ID: vg0312369772 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 12369772 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )
TTTTTGTTAAATCTCTTCTTTAGTACTCCCTCCATCTACTTTTCATAGACATATTTTATCTTGGCACACAGACCAAGGATAAGTAATTCTACTTATCATC[C/T,A]
ATTTAAACATGCTACTAGTCATTCCTCGTAAACAAGCGATTCATTAATATTTATATTTCTCGATGCCATATAGCCAATCTTGTGTGAAAGAATGGAGAGT
ACTCTCCATTCTTTCACACAAGATTGGCTATATGGCATCGAGAAATATAAATATTAATGAATCGCTTGTTTACGAGGAATGACTAGTAGCATGTTTAAAT[G/A,T]
GATGATAAGTAGAATTACTTATCCTTGGTCTGTGTGCCAAGATAAAATATGTCTATGAAAAGTAGATGGAGGGAGTACTAAAGAAGAGATTTAACAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 4.10% | 2.39% | 0.00% | A: 0.13% |
| All Indica | 2759 | 88.80% | 7.10% | 4.10% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 0.00% | 0.00% | 0.00% | A: 2.23% |
| Indica I | 595 | 58.70% | 26.90% | 14.45% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.10% | 1.08% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 3.80% | 2.80% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0312369772 | C -> T | LOC_Os03g21664.1 | upstream_gene_variant ; 2273.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> T | LOC_Os03g21680.1 | upstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> T | LOC_Os03g21664.2 | upstream_gene_variant ; 2273.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> T | LOC_Os03g21680.2 | upstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> T | LOC_Os03g21680.4 | upstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> T | LOC_Os03g21680.3 | upstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> T | LOC_Os03g21660.1 | downstream_gene_variant ; 3879.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> T | LOC_Os03g21670.1 | downstream_gene_variant ; 2366.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> T | LOC_Os03g21664-LOC_Os03g21670 | intergenic_region ; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> A | LOC_Os03g21664.1 | upstream_gene_variant ; 2273.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> A | LOC_Os03g21680.1 | upstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> A | LOC_Os03g21664.2 | upstream_gene_variant ; 2273.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> A | LOC_Os03g21680.2 | upstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> A | LOC_Os03g21680.4 | upstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> A | LOC_Os03g21680.3 | upstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> A | LOC_Os03g21660.1 | downstream_gene_variant ; 3879.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> A | LOC_Os03g21670.1 | downstream_gene_variant ; 2366.0bp to feature; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| vg0312369772 | C -> A | LOC_Os03g21664-LOC_Os03g21670 | intergenic_region ; MODIFIER | silent_mutation | Average:85.544; most accessible tissue: Callus, score: 93.096 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0312369772 | NA | 1.77E-07 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312369772 | NA | 8.18E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312369772 | 3.35E-06 | 2.32E-08 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312369772 | 5.78E-06 | 1.33E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312369772 | 1.67E-08 | 1.34E-10 | mr1389_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312369772 | 5.56E-08 | 1.53E-09 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |