\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312369772:

Variant ID: vg0312369772 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 12369772
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTGTTAAATCTCTTCTTTAGTACTCCCTCCATCTACTTTTCATAGACATATTTTATCTTGGCACACAGACCAAGGATAAGTAATTCTACTTATCATC[C/T,A]
ATTTAAACATGCTACTAGTCATTCCTCGTAAACAAGCGATTCATTAATATTTATATTTCTCGATGCCATATAGCCAATCTTGTGTGAAAGAATGGAGAGT

Reverse complement sequence

ACTCTCCATTCTTTCACACAAGATTGGCTATATGGCATCGAGAAATATAAATATTAATGAATCGCTTGTTTACGAGGAATGACTAGTAGCATGTTTAAAT[G/A,T]
GATGATAAGTAGAATTACTTATCCTTGGTCTGTGTGCCAAGATAAAATATGTCTATGAAAAGTAGATGGAGGGAGTACTAAAGAAGAGATTTAACAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 4.10% 2.39% 0.00% A: 0.13%
All Indica  2759 88.80% 7.10% 4.10% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 97.80% 0.00% 0.00% 0.00% A: 2.23%
Indica I  595 58.70% 26.90% 14.45% 0.00% NA
Indica II  465 97.80% 1.10% 1.08% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 3.80% 2.80% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0312369772 C -> T LOC_Os03g21664.1 upstream_gene_variant ; 2273.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> T LOC_Os03g21680.1 upstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> T LOC_Os03g21664.2 upstream_gene_variant ; 2273.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> T LOC_Os03g21680.2 upstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> T LOC_Os03g21680.4 upstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> T LOC_Os03g21680.3 upstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> T LOC_Os03g21660.1 downstream_gene_variant ; 3879.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> T LOC_Os03g21670.1 downstream_gene_variant ; 2366.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> T LOC_Os03g21664-LOC_Os03g21670 intergenic_region ; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> A LOC_Os03g21664.1 upstream_gene_variant ; 2273.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> A LOC_Os03g21680.1 upstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> A LOC_Os03g21664.2 upstream_gene_variant ; 2273.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> A LOC_Os03g21680.2 upstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> A LOC_Os03g21680.4 upstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> A LOC_Os03g21680.3 upstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> A LOC_Os03g21660.1 downstream_gene_variant ; 3879.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> A LOC_Os03g21670.1 downstream_gene_variant ; 2366.0bp to feature; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N
vg0312369772 C -> A LOC_Os03g21664-LOC_Os03g21670 intergenic_region ; MODIFIER silent_mutation Average:85.544; most accessible tissue: Callus, score: 93.096 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0312369772 NA 1.77E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312369772 NA 8.18E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312369772 3.35E-06 2.32E-08 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312369772 5.78E-06 1.33E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312369772 1.67E-08 1.34E-10 mr1389_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312369772 5.56E-08 1.53E-09 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251